Uv transilluminator

Solutions of 6 mM zinc(II) acetate, 6 mM cadmium(II) acetate, 16 mM MSA, and 100 mM phosphate buffer pH 7 were prepared. 43 μL of zinc(II) acetate, 7 μL of cadmium(II) acetate, 25 μL of MSA and 25 μL of phosphate buffer pH 7 were pipetted into the UV-transparent 96 well plate with a flat bottom by CoStar (Corning, KS, USA). Subsequently, the plate was placed into the UV transilluminator (Vilber Lourmat, Marne-la-Vallee Cedex, France) with λ_em = 254 nm and irradiated for 0, 1, 2, 4, 8, 16, and 32 min. The sample area of 20 × 20 cm was illuminated by 6 emitting tubes with a power of 15 W each. Subsequently, the wavelength of 250 nm was used for excitation and the fluorescence scan was measured within the range from 300 to 800 nm by Tecan Infinite 200 M PRO (TECAN, Switzerland).

A DNA ladder assay was performed to identify DNA fragmentation among apoptotic cells as previously described [12 (link)]. Briefly, 1 × 10⁶ cells/well were seeded into a 24-well, flat-bottomed plate and incubated in a 5 % CO₂ incubator at 37 °C for 24 h. After treatment of cancer cells with 2 × IC₅₀ of the 50 % ethanol–water extracts or melphalan for 24 h, the cells were collected and washed with medium. The DNA in the cell pellets was extracted using a FlexiGene DNA kit. Aliquots (2 μg) of the DNA were analyzed using electrophoresis at 100 V for 40 min in 1.8 % agarose gels containing 0.1 % ethidium bromide. After electrophoresis, the DNA fragments were visualized using a UV transilluminator (Vilber Lourmat Deutschland GmbH, Eberhardzell, Germany) and gel pictures were taken with a UV-illuminated camera (Syngene, UK).

We used 18 UBC (University of British Columbia) markers for the ISSR amplification: UBC802, UBC807, UBC808, UBC809, UBC810, UBC811, UBC813, UBC815, UBC816, UBC818, UBC821, UBC823, UBC825, UBC834, UBC850, UBC880, UBC856 and ISSR001 [53 (link),54 (link)], of which 12 were selected that provided higher numbers of fragments and better reproducibility. The 20 µL PCR solution consisted of: 10 µL Master Mix SapphireAmp 2× (Takara, Clontech, USA), 5 µL ISSR primer (5 µM), 1 µL genomic DNA (5 ng/µL) and 4 µL nuclease-free water. Amplifications were performed in a MultiGene Optimax thermal cycler (Labnet) using the following protocol: an initial step of 5 min at 94 °C, 45 cycles of 30 s at 94 °C, 45 s at 52 °C and 2 min at 72 °C, followed by a final extension step of 6 min at 72 °C. The amplification products were separated by agarose gel electrophoresis (1.2%) and colored with GelRed^TM (10,000×) at the ratio of 10 µL/100 mL of gel (with Tris-borate-EDTA at 0.5×). The electrophoresis run was performed at 100 V for 110 min. The gel was then placed in a UV trans illuminator (Vilber Lourmat, France) and photographed with a digital camera (Canon, SX160 IS. USA).

Dendriplexes and h-R3/EGF/HSA-dendriplexes with different compositions were evaluated by agarose gel retardation assay. Twenty microliters of complexes containing solution with 1 μg DNA was electrophoresed on the 1% (w/v) agarose gel containing ethidium bromide with Tris-acetate-EDTA (TAE) running buffer at 110 V for 30 min. DNA was visualized on a Vilber Lourmat UV transilluminator.

Virus placement was verified via PCR after behavioral testing. Genomic DNA was isolated from mPFC sections via QIAamp DNA FFPE Tissue Kit (Qiagen). The following primers were used to evaluate the virus placement against rtTA3 with the previously purified DNA: forward primer 5′GGAGGAACAGGAGCATCAAG3′ and reverse primer 5′GGCAGCATATCAAGGTCAAAG3′. 10× PCR-Buffer (MgCl₂), 25 mM MgCl₂, 10 mM dNTPs, Taq-Polymerase, and 70 ng DNA were filled up to a final volume of 52.8 µL with H₂O. The PCR protocol consisted of an initiation denaturation at 95°C for 5 min, followed by 50 cycles at 95°C for 30 s, annealing for 30 s at 60°C, and primer extension for 1 min at 72°C, and a final extension at 72°C for 10 min followed by holding at 4°C in the cycler (Eppendorf). All amplified results were analyzed via agarose gel electrophoresis, staining with Midori Green (NIPPON Genetics), and visualization of DNA bands using an UV transilluminator (Vilber). The synthesized amplicon for the rtTA3 had a size of 264 bp and determined by DNA Ladder (100 bp, New England Biolabs). Only subjects with a positive detection of the rtTA3 PCR product were used for data analysis.

RCA amplification reaction was performed in a 50 µl mixture containing; 2 µl ligation product, 8 U Bst DNA polymerase (New England Biolabs), 10 pmol of each RCA primer (Table 2), and 400 µM dNTP mix. The mixture was incubated at 65°C for 60 min and cooled at 10°C. Electrophoresis on a 1% agarose gel was used to visualize RCA products. A positive reaction is indicated by the presence of ladder-like pattern. The reaction was also visualized by adding 1.0 µl of a 10-fold diluted SYBR Green I (Cambrex BioScience, Workingham, U.K.) to 10 µl of the amplification product. Accumulated double stranded DNA was detected with UV transilluminator (Vilber Lourmat, Marne-la-Vallée, France).

The presence of probiotic marker genes encoding species-specific collagen-binding protein and bile salt hydrolase was confirmed in LPJBC5, as previously described [34 (link)] (Table S1). Additionally, L. plantarum specific sequence and anti-microbial gene (plantaricin-biosynthetic gene) was amplified and sequenced in LPJBC5 (Table S1) [35 (link),36 (link)]. The genomic DNA was extracted using a genomic extraction kit, and its concentration was determined using a NanoDrop^TM 2000c spectrophotometer (Thermo Scientific, USA). The PCR reaction was set up with a total reaction mixture of 25 μL containing 2.5 μL of 10× Taq buffer, 1.5 U of Taq DNA polymerase (Sigma, Darmstadt, Germany), 1.5 mM of MgCl₂, 100 μM of dNTP mixture, 10 pmol of each primer pair and 50 ng of bacterial DNA. The PCR was performed using the following conditions in a PCR thermal cycler (Eppendorf, Hamburg, Germany): 96 °C for 5 min, followed by 35 cycles of 94 °C for 30 s, 57 °C for 30 s, 72 °C for 1 min, and 72 °C for 5 min. The amplified product was run on 1.5% agarose gel and imaged under a UV transilluminator (Vilber, Collégien, France). Sequencing of purified PCR amplified fragments was performed with Macrogen Inc. (Seoul, Korea). The DNA sequences were subjected to BLAST analysis and submitted to NCBI (National Center for Biotechnology Information, Bethesda, Rockville, MD, USA) database.