3T3-L1 cells were grown and differentiated in six-well plates followed by 24-h treatment with PCB126, as described above. Cells were then lysed using RNease lysis buffer with 1% mercaptoethanol (Sigma-Aldrich) from the RNeasy Mini Kit (Qiagen) and lysates were stored at . Total RNA was extracted from cell lysates using the RNase Mini Kit where genomic DNA was removed using the RNase-Free DNase Kit (Qiagen) following the manufacturer’s recommendations. RNA concentration and extraction quality were measured using a NanoDrop™ 1000 Spectrophotometer (ThermoFisher). Then, RNA was reverse transcribed with iScript Complementary DNA (cDNA) Synthesis Kit (Bio-Rad) following the manufacturer’s protocol in a CFX96-polymerase chain reaction (PCR) Detection System (Bio-Rad). cDNA was amplified and quantified in a CFX96-PCR Detection System using the iQSYBR SsoFast EvaGreen Supermix (Bio-Rad). Primers for each target genes are summarized in Table 2 . All genes were normalized to levels and analyzed using the comparative cycle threshold ( ) ( ) method, as previously described (Schmittgen and Livak 2008 (link)). Each independent experiment ( ) was done in triplicate.
Iscript complementary dna cdna synthesis kit
Manufactured by Bio-Rad
Sourced in United States
The IScript complementary DNA (cDNA) synthesis kit is a laboratory product offered by Bio-Rad. The kit is used to convert RNA into cDNA, which is a single-stranded DNA molecule that serves as a template for various downstream applications in molecular biology and genetics.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Rneasy mini kit, by Qiagen (4 mentions)
Itaq universal sybr green kit, by Bio-Rad (3 mentions)
Ssoadvanced sybr green supermix kit, by Bio-Rad (3 mentions)
Cfx96 instrument, by Bio-Rad (2 mentions)
Rnase free dnase kit, by Qiagen (1 mentions)
Cfx96 pcr detection system, by Bio-Rad (1 mentions)
Rnase mini kit, by Qiagen (1 mentions)
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Iqsybr ssofast evagreen supermix, by Bio-Rad (1 mentions)
Isopropanol, by Avantor (1 mentions)
Acetonitrile, by Avantor (1 mentions)
Acclaim rslc 120 c18 column, by Thermo Fisher Scientific (1 mentions)
Bradford protein binding assay, by Bio-Rad (1 mentions)
Dulbecco s modified eagle medium dmem, by Thermo Fisher Scientific (1 mentions)
Formic acid, by Merck Group (1 mentions)
Mirneasy kit, by Qiagen (1 mentions)
Cfx connect, by Bio-Rad (1 mentions)
Ssoadvanced sybr green, by Bio-Rad (1 mentions)
Cfx96, by Bio-Rad (1 mentions)
21 protocols using iscript complementary dna cdna synthesis kit
1
RNA Extraction and qPCR Analysis of 3T3-L1 Cells
2
CRISPR-mediated TAZ knockout in HAP1 cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TAZ knockout of HAP1 (ΔTAZ) by clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) is a customized cell line purchased from Horizon Discovery (Cambridge, UK). Dulbecco’s modified eagle medium (DMEM) and fetal bovine serine (FBS) were purchased from Invitrogen (St. Louis, MO, USA). Bradford protein binding assay, iScript complementary DNA (cDNA) synthesis kit and SYBR Green system Super Mix were purchased from BioRad (Montreal, QC, Canada). Tetra-myristoyl cardiolipin CL(14:0)4 and phosphatidylglycerol(18:1)2 were purchased from Avanti Polar Lipids (Alabaster, AL, USA). Anti-DDK antibody was purchased from Novus (Littleton, CO, USA). Formic acid was purchased from Sigma-Aldrich (St. Louis, MO, USA). Acetonitrile and isopropanol were purchased from JT Baker (Phillipsburg, NJ, USA). Acclaim RSLC 120 C18 column was purchased from Thermo (Ottawa, ON, Canada).
3
Comprehensive Gene Expression Analysis
4
Quantification of Gene Expression via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was harvested using TRIzol reagent (Invitrogen) and then isolated using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol. Total RNA was reverse transcribed with an iScript complementary DNA (cDNA) Synthesis Kit (Bio-Rad). The resulting cDNA was used for real-time PCR using the iTaq Universal SYBR Green Kit (Bio-Rad). β-actin or Gapdh was used as an internal control. Real-time PCR and data collection were performed on a CFX96 instrument (Bio-Rad). Primers for qPCR are listed in Supplementary Table 1 .
5
Quantifying Gene Expression by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To investigate selected gene expressions in the four conditions mentioned above, qRT-PCR was performed. By using an iScript complementary DNA (cDNA) synthesis kit (Bio-Rad), cDNA was synthesized from total RNA that was isolated as mentioned previously. Real-time PCR detection was performed by using an SsoFast qPCR kit (Bio-Rad) for 40 cycles in a Bio-Rad CFX96. The relative fold changes in the gene levels were obtained from qRT-PCR data, by using ΔΔCt methods with respect to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) levels. The primer sequences for the selected genes are listed in SI Appendix, Table S1 .
6
Gene Expression Analysis of ECM Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One microgram of RNA was reverse-transcribed to cDNA using the iScript complementary DNA (cDNA) synthesis kit (#1708840, Bio-Rad Laboratories, Hercules, CA, USA), according to the manufacturer’s protocol. cDNA or DNA were used for quantitative real-time PCR (RT-qPCR) using the SsoAdvanced SYBR Green Supermix kit (#1725270, Bio-Rad Laboratories), according to the manufacturer’s protocol. Gene expression was normalized to beta actin. The genes of interest were: Eln (tropoelastin), Fbn1 (fibrillin-1), Lox (lysyl oxidase), Loxl1 (lysyl oxidase-like-1), Fbln5 (fibulin 5), Col1a1 (type I collagen alpha-1), Col1a2 (type I collagen alpha-2), Col3a1 (type III collagen alpha-1). The primer sequences used for analyses are listed in Appendix A.2 .
7
Quantitative RT-PCR analysis of gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol reagent (Invitrogen) and then reverse transcribed with an iScript complementary DNA (cDNA) Synthesis Kit (Bio-Rad). The resulting cDNA was used for real-time PCR using the iTaq Universal SYBR Green Kit (Bio-Rad). β-actin was used as an internal control. Real-time PCR and data collection were performed on a CFX96 instrument (Bio-Rad). The primer sequences are provided in Supplementary Table 1 .
8
Odorant-Binding Protein Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Isol RNA Lysis Reagent (5Prime) and treated with RNase-free DNase (Euromedex) to avoid genomic DNA contamination. Total RNA was reverse transcribed using the iScript complementary DNA (cDNA) Synthesis Kit (BioRad). The qPCR reactions were carried out on the MyIQ system (BioRad) using the IQ SYBR Green SuperMix (BioRad) and the primers described in Table 3 . Each reaction was performed in triplicate. All results were normalized to actin and rp-49 mRNA levels and calculated using the DDCt method48 (link).
Forward and reverse primers used for RT-qPCR.
| OBP gene | Forward primer | Reverse primer |
|---|---|---|
| Obp19b | CTGCAACGAGGAGCTAAAGG | AGCATGCACATAGCGATCC |
| Obp19d | CACCGATGAGGATGTGGAG | TGTTCAGCTTACCGGATTCA |
| Obp28a | ACTGGTGCGAGCCTTTGA | CTCTCGGCTGACTCCATCA |
| Obp56e | TGCAGCTCTATCTTTGGCATC | GGCCTTGGCTCTCTGCTT |
| Obp57b | AGGCTCCCGAAGAACTTTGT | GGATGGCCAGCCTTAAATG |
| Obp83a | CTTCTGCTAAAAGCGAACGAG | CATCCGTGAAACAGCAAAAAT |
| Obp83b | ATTTGTGCTCCCAAAACTGG | CTCATGAATTTGCCCATCG |
9
Laryngeal Tissue RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole larynges were thawed and hemisected. Mucosal and submucosal tissues, starting from the glottis until the lower end of subglottic regions were harvested from the hemisected larynges. Total RNA was extracted according to the RNeasy Mini Kit (Qiagen, Germantown, MD, USA). RNA quantity and quality (A260/A280) were estimated using the Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Rockford, IL, USA). Samples from control (n = 1), low and high dose groups (n = 2 each) with poor RNA yield and A260/A280 values were eliminated from subsequent analysis. RNA integrity number (RIN) values were computed for remnant RNA elutes (n = 4 per group). Isolated RNA from all samples had an acceptable RIN value > 8 (Supplementary Fig. S10 ). Subsequently, reverse transcription was performed with 0.6 μg of RNA per reaction according to the manufacturer’s instructions in the iScript™ complementary DNA (cDNA) synthesis kit (Catalog no. 170–8890; Bio-Rad, Hercules, CA, USA).
10
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligonucleotides for quantitative real-time PCR (sequences are listed in Supplementary Table IV ) were designed using Integrated DNA Technologies. Total RNA of 500 ng was reverse transcribed using the iScript complementary DNA (cDNA) synthesis kit (Bio-Rad). The reaction mix contained 5 μl of SsoAdvanced Universal Probes Supermix (Bio-Rad), 0.5 μl primer and probe corresponding to 250 nM primers and 125 nM probe (20 × stock) and 0.5 μl of cDNA. qPCR measurements were performed using a CFX96 real-time PCR machine (Bio-Rad). The relative expression levels were determined by a 2−ΔΔG method. Each sample was normalized by the cycle threshold geometric mean using reference genes rrsA and cysG59 (link). Biological replicates consisted of three E. coli cultures exposed to equivalent inducer concentrations (0 or 5 ng ml−1). Three qPCR technical replicates were performed and averaged for each sample.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!