Tissue processing and quantitative PCR (qPCR) were performed as previously described 30 (link). Sigma-Aldrich custom primers were used for genes of interest with the sequences shown in Supplementary Table 1 . All qPCR gene expression was normalized to the housekeeping gene GAPDH.
Custom primers
Manufactured by Merck Group
Sourced in United Kingdom
Custom primers are short nucleic acid sequences designed to act as starting points for DNA synthesis. They can be customized to target specific genetic regions of interest. Custom primers are a versatile tool for various applications in molecular biology and genetics.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (6 mentions)
Viia 7 system, by Thermo Fisher Scientific (3 mentions)
Genelute mammalian total rna purification miniprep kit, by Merck Group (3 mentions)
Primescript rt master mix, by Takara Bio (3 mentions)
Qpcrbio sygreen mix lo rox, by PCR Biosystems (3 mentions)
Inflammatory cytokines and receptors pathway, by Merck Group (2 mentions)
T4 dna ligase, by Roche (2 mentions)
Nanodrop one, by Thermo Fisher Scientific (2 mentions)
Mpk10025, by Thermo Fisher Scientific (1 mentions)
Influx high speed sorter, by BD (1 mentions)
Redtaq readymix, by Merck Group (1 mentions)
Neon transfection system mpk5000, by Thermo Fisher Scientific (1 mentions)
Murine leukemia virus reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Hif 2α, by Novus Biologicals (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Chip it express enzymatic kit, by Active Motif (1 mentions)
7500 real time pcr, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
14 protocols using custom primers
1
Tissue and qPCR Analysis Protocol
2
CRISPR-Mediated Knockout of DND41 PE Cells
3
Quantitative Analysis of Inflammatory Cytokines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cell lines using GenElute mammalian total RNA purification miniprep kit (Sigma-Aldrich) according to manufacturer’s instructions. Pure RNA was quantified at NanoDrop 2000 spectrophotometer (Thermo Scientific).
cDNA synthesis was performed starting from 500 ng of total RNA, using PrimeScript RT Master Mix (Takara Bio Inc.). The reaction was incubated at 37°C for 15 min and inactivated by heating at 70°C for 10 s. cDNA was amplified by real-time quantitative PCR, using the ViiA™ 7 System (Applied Biosystems).
All PCR reactions were performed in a 20 µL volume. Each reaction contained 10 µL of 2× qPCRBIO SYGreen Mix Lo-ROX (Pcrbiosystems), 400 nM concentration of each primer, and cDNA.
Custom primers belonging to the “Inflammatory Cytokines and Receptors” pathway were purchased from Sigma Aldrich. All experiments were performed including non-template controls to exclude reagents contamination. PCR was performed including two analytical replicates.
The amplification profile was initiated by 10 min incubation at 95°C, followed by two-step amplification of 15 s at 95°C and 60 s at 60°C for 40 cycles. As a final step, a melt curve dissociation analysis was performed.
cDNA synthesis was performed starting from 500 ng of total RNA, using PrimeScript RT Master Mix (Takara Bio Inc.). The reaction was incubated at 37°C for 15 min and inactivated by heating at 70°C for 10 s. cDNA was amplified by real-time quantitative PCR, using the ViiA™ 7 System (Applied Biosystems).
All PCR reactions were performed in a 20 µL volume. Each reaction contained 10 µL of 2× qPCRBIO SYGreen Mix Lo-ROX (Pcrbiosystems), 400 nM concentration of each primer, and cDNA.
Custom primers belonging to the “Inflammatory Cytokines and Receptors” pathway were purchased from Sigma Aldrich. All experiments were performed including non-template controls to exclude reagents contamination. PCR was performed including two analytical replicates.
The amplification profile was initiated by 10 min incubation at 95°C, followed by two-step amplification of 15 s at 95°C and 60 s at 60°C for 40 cycles. As a final step, a melt curve dissociation analysis was performed.
4
Quantification of Inflammatory and Antiviral Gene Expression
5
miniHPRT Gene Sequence Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TG-resistant colonies were picked and expanded. Genomic DNA was extracted and miniHPRT was amplified by PCR using the following custom primers purchased from Sigma-Aldrich.
miniHPRT Exon1-2 Forward: 5’-CTTCAAAAGCGCACGTCTGC-3’, miniHPRT Exon1-2 Reverse: 5’-CAAGTACTCAGAACAGCTGC-3’.
PCR conditions are: 98°C 5 minutes, followed by 40 cycles of reaction (98°C 1 minute, 45°C 1 minute, 72°C 1 minute), final extension is 72°C for 10 minutes. Amplified PCR products were sent for sequence for detection of mutations in miniHPRT. The miniHPRT Exon1-2 Reverse oligo was used for sequencing.
miniHPRT Exon1-2 Forward: 5’-CTTCAAAAGCGCACGTCTGC-3’, miniHPRT Exon1-2 Reverse: 5’-CAAGTACTCAGAACAGCTGC-3’.
PCR conditions are: 98°C 5 minutes, followed by 40 cycles of reaction (98°C 1 minute, 45°C 1 minute, 72°C 1 minute), final extension is 72°C for 10 minutes. Amplified PCR products were sent for sequence for detection of mutations in miniHPRT. The miniHPRT Exon1-2 Reverse oligo was used for sequencing.
6
Hypoxia Regulation of CTBP Promoters
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were performed on chromatin isolated from Hues-7 hESCs maintained on Matrigel at either 5% or 20% oxygen using the ChIP-IT Express Enzymatic Kit (Active Motif) and the following antibodies: HIF-2α (Novus Biologicals; NB100-122) and rabbit IgG (Santa Cruz; sc-2027). DNA samples were cleaned up before PCR analysis using the QIAquick PCR Purification Kit (QIAGEN). Recovered DNA was amplified using SYBR Green qPCR with custom primers (Sigma) spanning the potential HRE sites at −128 and −2,114 bp upstream of the transcription start site of the CTBP1 and CTBP2 proximal promoters, respectively (CTBP1 forward: ACACGTGTTCCCTCCTTCATG; CTBP1 reverse: CAGGTGTCACCAGAGCTTTGG; CTBP2 forward: CCTATGAAGGTCACGCGAAAA; CTBP2 reverse: TTGCCCGCTAGTCCACGTA).
7
Inflammation-related Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cell lines using GenElute Mammalian Total RNA Purification Miniprep Kit (Sigma-Aldrich, Inc,), according to manufacturer’s instructions. Pure RNA was quantified at NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA).
Complementary DNA (cDNA) synthesis was performed starting from 500 ng of total RNA, using PrimeScript RT Master Mix (Takara Bio, Inc., Kusatsu, Japan). The reaction was incubated at 37°C for 15 min and inactivated by heating at 70°C for 10 s. cDNA was amplified by real-time quantitative polymerase chain reaction (PCR) using the ViiA™ 7 System (Applied Biosystems, Foster City, CA, USA).
All PCR reactions were performed in a 20 µL volume. Each reaction contained 10 µL of 2× qPCRBIO SYGreen Mix Lo-ROX (PCR Biosystems, Ltd, London, UK), 400 nM concentration of each primer, and cDNA.
Custom primers belonging to the “Inflammatory Cytokines and Receptors” pathway were purchased from Sigma-Aldrich, Inc. All experiments were performed including non-template controls to exclude reagents contamination. PCR was performed including two analytical replicates.
The amplification profile was initiated by 10 min incubation at 95°C, followed by two-step amplification of 15 s at 95°C and 60 s at 60°C for 40 cycles. As final step, a melt curve dissociation analysis, was performed.
Complementary DNA (cDNA) synthesis was performed starting from 500 ng of total RNA, using PrimeScript RT Master Mix (Takara Bio, Inc., Kusatsu, Japan). The reaction was incubated at 37°C for 15 min and inactivated by heating at 70°C for 10 s. cDNA was amplified by real-time quantitative polymerase chain reaction (PCR) using the ViiA™ 7 System (Applied Biosystems, Foster City, CA, USA).
All PCR reactions were performed in a 20 µL volume. Each reaction contained 10 µL of 2× qPCRBIO SYGreen Mix Lo-ROX (PCR Biosystems, Ltd, London, UK), 400 nM concentration of each primer, and cDNA.
Custom primers belonging to the “Inflammatory Cytokines and Receptors” pathway were purchased from Sigma-Aldrich, Inc. All experiments were performed including non-template controls to exclude reagents contamination. PCR was performed including two analytical replicates.
The amplification profile was initiated by 10 min incubation at 95°C, followed by two-step amplification of 15 s at 95°C and 60 s at 60°C for 40 cycles. As final step, a melt curve dissociation analysis, was performed.
8
RNA Extraction and qPCR Analysis of Adipose Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An RNeasy Lipid Tissue Mini Kit (QIAGEN, Hilden, Germany) was used to extract RNA from eWAT (n = 5–6) and iBAT (n = 5–7). The extracted RNA quantity and quality were determined using NanoDrop One (Thermo Scientific, Wilmington, DE, USA), and the RNA was stored at −80 °C. Equivalent amounts of the total RNA were reversely transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, MA, USA). Quantitative real-time PCR was performed in duplicates with the 7500 Real-Time PCR (Applied Biosystems, Waltham, MA, USA), FastStart Universal Probe Master ROX (Roche, Pleasanton, CA, USA), probes labeled at the 5′ end with fluorescein (FAM) and at the 3′ end with a dark quencher dye (Universal ProbeLibrary, Roche, Indianapolis, IN, USA) and custom primers (Sigma-Aldrich, St. Louis, MO, USA). A predesigned qPCR assay (PrimeTime® Mini 135qPCR Assay, Integrated DNA Technologies, Coralville, IA, USA) was used for the quantification of Pparγ expression. All probes and primers are listed in the Supplementary Data (Supplemental Table S2 ). Relative quantification was done using the 2−ΔΔCT method against control glyceraldehyde-3-phosphate dehydrogenase (Gapdh) [42 (link)]. The results are expressed as fold-change relative to the HFD group.
9
Generation of SNAP23 Cysteine Mutants
10
Tissue Processing and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue processing and quantitative PCR (qPCR) were performed as previously described [28 (link)]. Sigma-Aldrich custom primers were used for genes of interest with the sequences shown in Supplementary Table 1 . All qPCR gene expression was normalized to the housekeeping gene GAPDH.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!