Flexcycler2

The microorganism strains were cultivated on Muller Hinton agar (Himedia, Mumbai, India), incubated at 37 °C for 24 h. Further, the boiling method was used for DNA extraction in this study [54 (link)]. Primers used in this study are follows: norA sequence (5′-->3′) 436 bp, forward: GTTACTTGTTGCTGCTTTTG and reverse: GCTTGTCGTAGACTTTTTCG [55 (link)] and mecA sequence (5′-->3′) 286 bp, forward: TGCTATCCACCCTCAAACAGG and reverse: AACGTTGTAACCACCCCAAGA [54 (link)]. PCR amplification was performed using FlexCycler2 PCR thermo cycles machine (Analytik Jena AG, Thuringia, Germany). Amplification was achieved by a series of steps: norA and mepA genes were initially denatured at 94 °C for 5 min; 35 cycles of 94 °C for 30 s, 58 °C for 30 s, 72 °C for 30 s, followed by final elongation at 72 °C for 7 min. For the mecA gene, the following temperature cycling was used: initial denaturing at 95 °C for 5 min, 30 cycles of 95 °C for 1 min, 55 °C for 1 min, 72 °C for 1 min, and a final extension at 72 °C for 10 min. Analysis of PCR products was conducted using 2% agarose gel electrophoresis (Cleaver Scientific, Warwickshire, UK). The gels were then exposed to UV light and the images were generated using the GeneFlash gel documentation system (Syngene, Frederick, MD, USA).

Genomic DNA (gDNA) was isolated from D. lanata shoots according to Allen et al. (2006 (link)). A maximum of 100 mg plant material was ground in cold extraction buffer in a 1.5 mL reaction tube using a small pestle. The solution was rapidly heated to 65 °C and kept under these conditions for 30 min. The gDNA pellets obtained by centrifugation (20,000 × g; 20 °C) were dried at 30 °C and resuspended in sterile water.
Integration of T-DNA was verified by PCR with gDNA from shoots grown on medium I and primers against the genes nptII and GUS inserted in the T-DNA region. Additional PCRs against spectinomycin (SmR) resistance gene and virD2 gene were conducted to exclude the presence of Ti-plasmids (Suppl. Table S1; Suppl. Fig. S1). For PCR, FastGene Optima HotStart Ready Mix (Nippon Genetics Europe GmbH, Düren, Germany) and FlexCycler² (Analytik Jena AG, Jena, Germany) were used. The PCR program consisted of an initial denaturation (95 °C for 60 s), 29 cycles (95 °C for 15 s; T_A (Suppl. Table S1) for 30 s; 68 °C for 30 s) and a final amplification (68 °C for 600 s).
GUS activity was demonstrated by histochemical staining (Jefferson et al. 1987 (link)).

Samples were preserved in 75% ethanol at ambient temperature. DNA was extracted by a DNeasy Plant Mini Kit (Qiagen #68163, Venlo, The Netherlands). Two sets of primers 16Santa1a: 5′-GCCATGAGTATAGACGCACA-3′/16SbmoH: 5′-CGAACAGCCAACCCT TGG-3′ and HCO2198:5′-TAAACTTCAGGGTGACCAAAAAATCA-3′/LCO1490: 5′-GGTCAACAAATCATAAAGATA TTGG-3′ were chosen to amplify the mitochondrial 16S (mt 16S), respectively. PCR amplifications were worked using FlexCycler² (analytik jena) (Jena, Germany) with the latter conditions: 94 °C (1 min), 40 cycles of 98 °C (10 s), 52 °C (1 min), and 68 °C (1 min), with the last extension at 68 °C (5 min). The purified PCR products were analyzed by Genomics BioSci & Tech. (New Taipei City, Taiwan) for sequencing services. The mt 16S rDNA gene sequence were compared with NCBI database. Consequently, the research sample shared 100% sequence identity with Palythoa mutuki (GenBank: DQ997847.1).

Plasmid DNA was prepared using the ZR Plasmid Miniprep-Classic Kit (Zymo Research Corp, Irvine, CA, USA). Competent E. coli NEB 10-β cells (New England Biolabs, Herts, United Kingdom) were used for all cloning steps. Restriction enzymes were supplied from New England Biolabs (Herts, United Kingdom). T4 ligase was from Agilent (Santa Clara, CA, USA), and thermostable DNA polymerase iProof™ High-Fidelity was purchased from BioRad (Hercules, CA, USA). dNTPs were from Roche Diagnostics GmbH (Mannheim, Germany). PCR reactions were performed in a FlexCycler² (Analytik Jena AG, Jena, Germany) using the appropriate cycling conditions. PCR products were purified using the DNA Clean & Concentrator-5 Kit from Zymo Research Corp (Irvine, CA, USA). Accuracy of genetic constructs was verified by sequencing (Microsynth AG, Balgach, Switzerland).

The mixtures of extracted DNA molecules from the fish gills and livers were successfully amplified by 25 inter-simple sequence repeat (ISSR) primers (Table 2) in a PCR cycler (Flex Cycler², Analytikjena) [27 (link)]. Each DNA band was evaluated and recorded as the following diallelic characters: present = 1 and absent = 0. All of the evaluated band results were transferred to the set dendrogram for genetic similarity/differentiation evaluation of the catfish from the studied areas [28 ].

The temperature optimum was determined by conducting the oxidation reaction at different temperatures in the range between 20 and 90 °C. For this, the reaction mixture without enzyme was preheated to the desired temperature in a reaction tube by using a heating block (Eppendorf ThermoMixer^®C, Eppendorf SE, Hamburg, Germany) for at least 45 min. The reaction mixture had a volume of 200 µL. Thirty millimolars of benzyl alcohol and 0.5 mM of NAD⁺ were employed as substrates, and the reaction was carried out at different temperatures ranging from 20 to 90 °C in a 50 mM NaPi buffer at pH 7.5. The reaction was initiated by the addition of an enzyme with a final concentration of 0.1 mg mL⁻¹. For the thermostability determination, the purified ADH (1 mg mL⁻¹) was incubated in 50 mM NaPi buffer at pH 7.5 for 1 or 4 h in a gradient thermal cycler (FlexCycler², Analytik Jena, Jena, Germany) at various temperatures ranging from 20 to 80 °C. Residual activity was then determined as described above and compared with a control that was incubated on ice. The assay conditions were as follows: the reaction volume was 200 µL, the final enzyme concentration was 0.1 mg mL⁻¹, the substrate was 10 mM benzyl alcohol, and the reaction was performed at 40 °C in 50 mM NaPi buffer at pH 7.5. The reaction was initiated by the addition of 0.5 mM NAD⁺.