According to the instruction manual, total RNA was first extracted from the tissue using TRIzol, and total RNA was then identified and quantified with the NanoDrop and Agilent 2100 bioanalyzers and converted to complementary DNA using the RT reagent Kit for real‐time PCR using the PCR mixture and a Halo 480II System (Roche). The mRNA levels were normalized to the β‐actin levels and are reported as fold changes compared with the control group. The sequences of the primers were as follows: Pycr1 (forward, 5′‐GAAGATGGCAGGCTTGTGGA‐3′, reverse, 5′‐CTGGGAAGCCCCATTTTCAC3′) and β‐actin (forward, 5′‐AGGGAAATCGTGCGTGACAT‐3′, reverse, 5′‐CGCAGCTCAGTAACAGTCCG‐3′).
Rt reagent kit
Manufactured by Roche
Sourced in United States
The RT reagent Kit is a set of laboratory reagents used for Reverse Transcription (RT) reactions. The kit provides the necessary components to convert RNA into complementary DNA (cDNA), which can then be used for various downstream applications such as PCR or gene expression analysis. The kit includes a Reverse Transcriptase enzyme, buffer, and other essential reagents for the RT reaction.
Automatically generated - may contain errors
Lab products found in correlation
Agilent 2100, by Agilent Technologies (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Lightcycler 96, by Roche (1 mentions)
Sybr premix ex taqtm, by Roche (1 mentions)
Light cycler 2.0 systems, by Roche (1 mentions)
Mastercycler ep realplex, by Eppendorf (1 mentions)
Trizol, by Roche (1 mentions)
5 protocols using rt reagent kit
1
Gene Expression Analysis by qRT-PCR
2
Quantitative Real-Time RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time quantitative reverse transcription PCR (qRT-PCR) analysis was performed 12 h after the liver or cells were treated. Total RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. Total RNA (1 mg) extracted from each sample was reverse transcribed to cDNA in a 20 μL reaction mixture using an RT reagent kit (Roche) according to the manufacturer's directions. Real-time qRT-PCR was performed for the candidate genes and for GAPDH as the internal control. Quantitative real-time PCR was performed in a Light Cycler Real-Time PCR machine using Roche Fast Start Universal SYBR Green Master (Rox). The primers are shown in Table 1 . The specificity of the PCR products was verified by melting curve analysis. Each sample was analyzed in triplicate.
3
Quantitative Real-Time PCR Assay for Fibrotic Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the treated cells or kidney tissue using TRIzol according to the manufacturer's instructions. Total RNA (400 ng) was reverse transcribed to cDNA using the PrimeScript RT reagent kit at 37°C for 15 min and 85°C for 15 sec. qPCR was performed using SYBR-Green dye I and the LightCycler96® (Roche Diagnostics GmbH). The sequences of the RT-qPCR primers were as follows: Fibronectin forward, 5′-AGGCTGGATGATGGTGGACT-3′ and reverse, 5′-TGCTCCACGTGTCTCCAATC-3′; collagen 4A1 forward, 5′-GGCATTGTGGAGTGTCAACC-3′ and reverse, 5′-ACAGGCAAGGCAGCTCTCTC-3′; and β-actin forward, 5′-ACTGCTCTGGCTCCTAGCAC-3′ and reverse, 5′-ACATCTGCTGGAAGGTGGAC-3′. The thermal profile settings were as follows: Initial denaturation at 95°C for 30 sec, followed by 40 cycles of denaturation at 95°C for 5 sec and annealing at 60°C for 31 sec. The relative mRNA expression levels were normalized to the expression of β-actin and calculated using the 2−ΔΔCq method (25 (link)).
4
Quantitative RNA Analysis in HCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from HCC tissues or xenografts of nude mice or cultured cells according to the manufacturer’s instructions for TRIzol reagent. Total RNA (500 ng) was used for reverse transcription using PrimeScript RT reagent Kit and subjected to quantitative real-time PCR analysis (quantitative PCR, qPCR) using SYBR Premix Ex Taq TM and a Roche’s capillary-based Light Cycler 2.0 Systems. Target mRNA was determined using the comparative cycle threshold method of relative quantification. The calibrator sample was selected from adjacent non-tumor tissues or CON-HepG2 cell samples and β-actin was used as an internal control.
5
Quantitative Real-Time PCR Transcriptome Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol (Roche, USA) under low-temperature conditions and reverse transcribed into cDNA using the PrimeScript RT Reagent Kit with gDNA Eraser. The mRNA expression levels were determined using the SYBR® Premix Ex Taq II reagent kit in a Mastercycler ep realplex (Eppendorf, Germany) instrument. The reaction system was 10 µL of SYBR Premix Ex TaqII (2×), 2 µL of cDNA, 0.5 µL each of forward and reverse primers, and 7 µL of sterile deionized water for a total volume of 20 µL. PCR was performed using the two-step method: denaturation at 95°C for 30 s and 40 cycles of denaturation at 95°C for 5 s and annealing at 60-65°C for 30 s. The melting curve was plotted for 65-95°C. Each experiment was repeated three times. The primers are shown in Table 1.
Table 1 Primer sequences of real-time fluorescence-based quantitative PCR
Table 1 Primer sequences of real-time fluorescence-based quantitative PCR
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!