Cfx connect detection system

Leaf tissue was collected 3 weeks after TRV inoculation to test the downregulation of ribosomal protein-encoding gene transcripts in N. benthamiana-silenced plants. The total RNA was extracted from silenced and mock-infiltrated plants and the first-strand cDNA was synthesized with oligo(dT₁₅) primers using M-MuLV Reverse Transcriptase (New England Biolabs, Whitby, ON, Canada), according to the manufacturer’s instructions. The RT-qPCR was performed using the CFX Connect detection system (Bio-Rad Laboratories, Mississauga, ON, Canada). ACT 1 and EF1α were used to normalize the transcript levels [51 (link)]. Each sample was run in triplicate and repeated six times from two pooled biological replicates of silenced and non-silenced plants. The average of the six experiments was calculated and the results were graphed, with the corresponding standard deviations indicated with bars in the figures. The primers used in this study are listed in Table S4.

Lungs were harvested at 3- or 6-days after infection. Left lung tissue from infected and control mice was minced and frozen at 10 μl/mg in RLT buffer (Qiagen, Valencia CA). 20 mg lung tissue were homogenized with Lysing Matrix D-tubes using Fastprep24 using two 15 sec cycles and RNA extracted following Qiagen RNeasy Plus Mini Kit instructions. cDNA was generated using iScript reagents and protocol (Bio-Rad) and analyzed by real-time PCR using the Bio-Rad CFX connect detection system. H1N1 virus levels were quantified using Influenza A primer and probe set obtained through BEI Resources, NIAID, NIH: Influenza Virus Real-Time RT-PCR Assay, NR-15592. Cytokines were quantified using PrimePCR^TM Probe Assays for mouse Ifng, Il6, and Il22 (Bio-Rad). GAPDH was used as a housekeeping gene and quantified using Mm.PT.39a.1 qPCR assay (IDT, Coralville, IA). All data was quantified as fold-change mRNA by ΔΔCt method relative to control mice. Any outliers identified by Grubbs analysis (maximum 1 per dataset) were removed from final analyses. For a full primer list see Supplementary Table 1.

RNA was extracted from the cecum of the pig using a TRIzol reagent (Invitrogen, Carlsbad, CA) and the extracted RNA was reverse-transcribed into cDNA using PrimeScript RT Reagent Kit (Takara, Dalian, China). Then, real-time PCR was performed using a CFX Connect Detection System (Bio-Rad, Hercules, CA, United States), and the thermocycler protocol refer to our previous methods (Yi et al., 2018 (link)). The primers used for real-time polymerase chain reaction (PCR) are summarized in Supplementary Table 2, and GAPDH was used as the reference gene. Quantitative detections of total bacteria (forward: CGGTGAATACGTTCYCGG; reverse: GGWTACCTTGTTACGACTT), Escherichia coli (forward: CATGCCGCGTGTATGAAGAA; reverse: CGGGTAACGTCAATGAGCAAA), Lactobacillus (forward: CGATGAGTGCTAGGTGTTGGA; reverse: CAAGATGTCA AGACCTGGTAAG) were performed by qPCR using the StepOne PlusTM System.

Total RNA was extracted from the cultured cells, villous tissues, and placental tissues using TRIzol reagent (Invitrogen, Carlsbad, USA) according to the manufacturer's instructions. The RNA concentration was measured by ultraviolet spectroscopy (Nanodrop 2000; Thermo). Total RNA (1 μg) was used for reverse transcription with a Prime Script RT reagent kit (Roche Life Science, Mannheim, Germany). Primers were synthesized by TSINGKE Biological Technology; GAPDH was used as an endogenous control for gene expression analysis. The sequences of the PCR primer pairs for each gene are shown in Table S3. Quantitative RT‐PCR was carried out using a Bio‐Rad CFX Connect Detection System (Bio‐Rad, Hercules, USA). PCR cycling conditions included predenaturing at 95°C for 3 min, followed by 40 cycles (94°C for 5 s, 58°C for 15 s, and 72°C for 15 s) and extension at 72°C for 30 s. The threshold cycle Ct value was defined as the fractional cycle number at which the fluorescence passed the fixed threshold.

Gene expression analysis was performed on RNA extracted from 4-week-old soil-grown plants using the Genezol Total RNA kit (Geneaid) according to the manufacturer’s instructions. RNA quality was assessed by agarose gel electrophoresis and quantified by spectrophotometry. 1 µg of each sample was reverse transcribed into cDNA with the M-MuLV Reverse Transcriptase (New England Biolabs Canada). Quantitative RT-PCR amplification was done on a CFX Connect detection system (Bio-Rad Laboratories, Mississauga, On, CA) using SYBR Green PCR Master Mix (Bioline). 100 ng cDNA template and 0.4 µM of each primer (listed in Supplementary Table 1) were used in a final volume of 20 µl. The qRT-PCR thermal profile was 95 ˚C for 2 min, 40 cycles of 95 ˚C for 5 s, 60 ˚C for 10 s, and 72 ˚C for 5 s. The data were analyzed with CFX Maestro qPCR software. At1g13320 was used as a reference gene since it was previously demonstrated to be amongst the most stable genes in Arabidopsis (Czechowski et al. 2005 (link)) and was also used as a reference gene in a similar study (Vos et al. 2015 (link)). The expression level of each gene was calculated according to the ^ΔΔCt method. Three technical replicates for each treatment were analyzed.

Epididymal adipose tissue from C57BL/6J mice was homogenized by using Precellys tissue homogenizer. Total RNA was isolated from homogenized tissues and cell lines byTRIzol Reagent (Thermo Fisher Scientific, Waltham, Massachusetts, MN, USA, Cat# 15596026), according to the manufacturer’s instructions. Isolated RNA was quantified with NanoDrop spectrophotometer and was reverse transcribed using “High-Capacity cDNA Reverse Transcription kit” (Thermo Fisher Scientific, Waltham, Massachusetts, MN, USA, Cat# 4368813). Gene expression analysis was performed by quantitative PCR assays using iTaq Universal Sybr Green Supermix (Bio-Rad, Hercules, CA, USA, Cat# 1725125), according to the manufacturer’s instructions, on a CFX Connect Detection System (Bio-Rad, Hercules, CA, USA). The specific primer pairs were designed using the Oligo 4.0 program and are listed in Table S1. The specificity of the amplification reaction was confirmed by melt curve analysis. PPIA, RPS23 and 36b4 were selected as reference genes for analyzing human and mouse samples, respectively. Relative expression analysis was performed using the 2^−ΔΔCt method, except for the analysis of TNFA expression levels assessedin the Leipzig cohort by the ΔCt method. All reactions were performed in duplicate in at least three independent experiments.