Klf15

The heart tissue chips are dewaxed and rehydrated. Citric acid sodium buffer solution was added for antigen retrieval. For cultured cells, they were washed with phosphate buffered saline (PBS) and then fixed with 4% paraformaldehyde. The washed heart tissue chips or cells were then permeabilized with 0.1% Triton X-100 and blocked with 3% bovine serum. They were stained with one or more corresponding antibodies (cTnI, abcam, 1:100; WWP1, abcam, 1:100; F4/80, abcam, 1:100; KLF15, Santa Cruz, 1:25, DAPI, Invitrogen). Five fields were randomly selected from the infarct, border, and remote zones of MI heart. The border zone was defined as the immediate neighboring area around the infarct. Fluorescence measurements were performed using the confocal microscope (Zeiss, German). The Image J software was applied for quantitative analysis.

Liver samples were homogenized in modified RIPA buffer containing 50 mM Tris, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.5% sodium deoxycholate and 1% SDS supplemented with protease and phosphatase inhibitors (Roche). CYP7A1 (Catalog #: sc25536, 200 μg ml⁻¹, 1:500 dilution), CYP7B1 (Catalog #: sc26087, 200 μg ml⁻¹, 1:500 dilution) and β-actin (Catalog #: sc47778, 200 μg ml⁻¹, 1:1,000 dilution) antibodies were purchased from Santa Cruz and KLF15 (Catalog #: ab2647, 0.5 mg ml⁻¹, 1:1,000 dilution) antibody was from Abcam (Cambridge, MA, USA) for immunoblot analyses. Immunoblot signals were quantified using ImageJ (ImageJ 1.48v, NIH). Full-length images of immunoblots are shown in Supplementary Figures 7–8.

ChIP-qPCR assays were performed using the Simple ChIP Plus Sonication Chromatin IP Kit (CST, #56383) as per the manufacturer’s protocol. Chromatin was fragmented by sonication. A 5-min 2-s open/1-s closed treatment period (sonication time was 5 min) and 30% amplitude were applied. For each ChIP reaction, 10 µg of chromatin were immunoprecipitated using 5 µL of antibodies against PGR (Santa Cruz Biotechnology) or KLF15 (Santa Cruz Biotechnology). The immunoprecipitated samples were then incubated at 4°C overnight with shaking. The sequences of the primers used for the PGR response element in the KLF15 gene and the KLF15 response element in the TWIST2 gene are provided in Table 2. Immunoprecipitation with normal rabbit IgG was performed as a negative control. The resulting signals were normalized to input DNA.
Table 2

Primers used in ChIP-qPCR.

	Primer
Primers used for the PGR response element in KLF15 gene
Primer1	AAAACGTCCCCTAGAACGGC
	TGAAGTTGAACCCGAGACCG
Primer2	TAAGAAATGGTCCCCGACACG
	GGACCGCCAGTGTAAGGAC
Primer3	GGCAAAACTGAAAGTGCCG
	AATAGTTGTCAGGAGCTAGGGC
Primers used for KLF15 response element in TWIST2 gene
Primer1	GCTGGATTATGCCTCTGTGAT
	TTTGGTATTTATTTGCTGGTAGTT
Primer2	CGCTGCACCACATCTGGAAG
	TAACCTCGCTCGGTGAGCCC
Primer3	GGCTCTCATTAACACCAGAGGCT
	GCTTCCAGATGTGGTGCAGCG

Nuclear extracts from C2C12 cells were prepared using the Nuclear Extract Kit (Active Motif Corp., Carlsbad, CA, USA) according to the manufacturer’s protocol. The protein concentration in the nuclear fraction was determined using the Bradford dye assay (Bio-Rad Corp., Richmond, CA, USA). All of the DNA probes used in the EMSA assays (listed in Supplementary Table S1) were synthesized (Invitrogen) and labeled at the 5′ end with biotin. Briefly, 10 μg of nuclear protein extract was incubated with 2 μL 10× binding buffer and 1 μL poly (dI.dC) in a volume of 20 μL for 15 min on ice. Then 200 fmol of the labeled probes were added and the reaction mixture was allowed to incubate at room temperature for 20 min. For the competition assay, unlabeled probes or mutated probes were added to the reaction mixture 15 min before adding the labeled probes. For the super-shift assay, 10 μg each of E2F1, Sp1, KLF15, or E2F4 (Santa Cruz, USA) antibody was added to the reaction mixture and then incubated on ice for 30 min before adding the labeled probes. Finally, the main complexes were resolved by electrophoresis in 6% non-denaturing polyacrylamide gel electrophoresis (PAGE) using 0.5× TBE buffer for 1 h.