Pmd2 g 12259

Short hairpin RNA (shRNA) targeting CRBN (CCGGGCCCACGAATA GTTGTCATTTCTCGAGAAATGACAACTATTCGTGGGCTTTTTG) constructed in the pLKO.1 lentiviral vector [16 (link)] and pLX304-CRBN-V5 vector [22 (link)] was a kind gift from Dr. X. Liang (Cancer Science Institute, Singapore). For lentivirus preparation, the envelope plasmid and packaging plasmid were purchased from Addgene (pMD2.G: #12,259; psPAX2: #12,260; Cambridge, MA, USA). pMD2.G, psPAX2 and the transfer plasmid were cotransfected into 293FT cells using polyethylenimine (linear MW 25,000 Da, 5 mg/mL, pH 7.0) (cat. No. 23966–1; Polysciences, Warrington, PA, USA) according to the manufacturer’s instructions. After 6 h, the culture medium was completely replaced with fresh medium. The viral supernatant was harvested at 48 h post-transfection and filtered through a 0.22 μm filter. T-ALL cells were then infected with lentivirus in the presence of 10 μg/mL Polybrene (Sigma-Aldrich) for 24 h. Stable cell lines were selected with puromycin or blasticidin (Sigma-Aldrich).

Small interfering RNA (siRNA) with pre-designed sequences targeting human NFATc1, PPP3R1, ALDH1A1 and scramble siRNA were from Sigma-Aldrich (St Louis, MO). pGL3-NFAT luciferase (17870), two shRNA sequences targeting SOX2, pLKO.1 Sox2 3HM a (26353) and pLKO.1 Sox2 3 hr b (26352), the negative control vector pLKO.1-puro (1864), the envelope vector pMD2.G (12259) and packaging vector psPAX2 (12260) were purchased from Addgene (Cambrige, MA; http://www.addgene.org). The pLKO.1-lentiviral shRNA with different inserts specifically targeting NFATc2 were purchased from Sigma-Aldrich (TRCN0000016144, TRCN0000230218). Human full length NFATc2 were amplified by PCR, and the RFP-NFTAc2 plasmids were generated by cloning the sequences into PCDH-CMV-MCS-EF1-COPRFP vector (SBI, Mountain View, CA). For luciferase reporter construction, SOX2 regulatory regions were amplified by PCR from human genomic DNA and cloned into pGL3 (Promega) to generate the SOX2-luc constructs. Primers used for genomic DNA amplification were listed in Supplementary file 1A. Site directed mutagenesis of the consensus NFAT binding site (GGAAA to GACTA) were performed using QuikChange (Stratagene).

Packaging, psPAX2 (12260), envelope, pMD2.G (12259) and eGFP only (control) (12254) were all sourced from Addgene. All plasmids were sent to the Department of Biochemistry Sanger Sequencing lab to ensure all sequences were correct before any experiments were conducted. Packaging, envelope and TREM2 transfer plasmids were combined according to the Addgene lentiviral production protocol. The plasmid complexes were then transfected into HEK 293 T cells using polyethylenimine (PEI) (Sigma, 408727) transfection reagent in a 3:1 ratio of PEI:DNA. After 24 h, media was exchanged. After a further 24 h, media was harvested, centrifuged and filtered through a 0.45‐micron filter. These media (containing lentiviral particles) were then added to BV‐2 or CHME‐3 cells at 50%–60% confluency with the addition of 8 μg/ml polybrene (Merck, TR‐1003‐G). After 18 h, cells were harvested and eGFP expression was assessed using flow cytometry (Cytoflex, Beckman). Cells that were positive for eGFP were Fluorescence‐Activated Cell Sorting (FACS) (Aria III) sorted by the University of Cambridge Flow Cytometry unit located in the Department of Pathology, collecting only the highest 25% of eGFP‐expressing cells, and therefore the highest, eGFP only, eGFP‐WT‐TREM2 and eGFP‐R47H‐TREM2 expressing cells were used for experiments.