Analysis of protein expression and IP experiments was performed by resolving proteins by SDS-PAGE, transfer to PVDF and immunoblotting. Primary antibodies used for immunoblotting were: anti-FLAG (Proteintech, 20543-1-AP, 1:4000), anti-HA (Cell Signaling, 2367, 6E2, 1:1125), anti-NAF1 (Abcam, ab157106, 1:1000), anti-NHP2 (Proteintech, 15128–1-AP, 1:5000), anti-NOP10 (Abcam, ab134902, 1:500), anti-TCAB1 (Novus, NB100–68252, 1:2000), anti-reptin (Abcam, ab51500, 1:5000), anti-hTERT (Santa Cruz, sc7215, C-20, 1:500), anti-dyskerin (Santa Cruz, sc-373956, H-3, 1:1500), anti-PARN (Abcam, ab154214, 1:500), anti-RRP40 (Bethyl, A303–909A-T, 1/1500), anti-TIP60 (Santa Cruz, sc5725, N-17, 1/1000), anti-hGAR1 (from Dr Witold Filipowicz (40 (link)), 1/2000) and anti-actin (Chemicon MAB1501, 1:5000).
Anti tip60
Manufactured by Santa Cruz Biotechnology
Anti-Tip60 is a lab equipment product offered by Santa Cruz Biotechnology. It is an antibody that specifically recognizes the Tip60 protein. Tip60 is a histone acetyltransferase involved in various cellular processes, including DNA repair and transcriptional regulation. The Anti-Tip60 product can be used for the detection and study of the Tip60 protein in biological samples.
Automatically generated - may contain errors
Lab products found in correlation
Anti mrtf a, by Santa Cruz Biotechnology (2 mentions)
Anti flag, by Merck Group (2 mentions)
Anti ha, by Abcam (2 mentions)
Anti actin, by Merck Group (1 mentions)
Mab1501, by Merck Group (1 mentions)
Anti ha, by Cell Signaling Technology (1 mentions)
Anti flag, by Proteintech (1 mentions)
Ab157106, by Proteintech (1 mentions)
Anti naf1, by Abcam (1 mentions)
Anti nhp2, by Proteintech (1 mentions)
Anti nop10, by Abcam (1 mentions)
Nb100 68252, by Abcam (1 mentions)
Anti htert, by Santa Cruz Biotechnology (1 mentions)
Anti dyskerin, by Santa Cruz Biotechnology (1 mentions)
250 sonicator, by Emerson (1 mentions)
Anti ash2, by Fortis Life Sciences (1 mentions)
Anti acetyl h3k9, by Merck Group (1 mentions)
Anti acetyl h3k27, by Merck Group (1 mentions)
Anti trimethyl h3k4, by Merck Group (1 mentions)
Sc 47778, by Santa Cruz Biotechnology (1 mentions)
8 protocols using anti tip60
1
Protein Expression and IP Analysis
2
Chromatin Immunoprecipitation Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation assays were performed essentially as described before (Liu et al., 2018 (link), 2019a (link),b (link); Zeng et al., 2018 (link); Zhang et al., 2018 (link); Li et al., 2018a (link)–e (link), 2019b –f ; Yang Y. et al., 2018 (link); Yang et al., 2019a (link),b (link); Fan et al., 2019 (link); Lu et al., 2019 (link); Shao et al., 2019 (link); Weng et al., 2019 (link); Zhao et al., 2019 (link); Kong et al., 2019a (link),b (link)). Briefly, chromatin was cross-linked with 1% formaldehyde. DNA was fragmented into 500 bp pieces using a Branson 250 sonicator (30% output power; 6 cycles of 10s sonication + 10s intermission). Aliquots of lysates containing 200 μg of protein were used for each immunoprecipitation reaction with anti-MRTF-A (Santa Cruz, sc-32909), anti-Tip60 (Santa Cruz, sc-166323), anti-trimethyl H3K4 (Millipore, 07–473), anti-acetyl H3K9 (Millipore, 07–352), anti-acetyl H3K27 (Millipore, 07–360), anti-acetyl H4K16 (Millipore, 07–328), anti-ASH2 (Bethyl Laboratories, A300–489A), or pre-immune IgG. Precipitated DNAs were amplified with the following primers: Nos2 promoter, 5′-AGAGTGATGTAATCAAGCAC-3′ and 5′-AAAGTTGTGACCCTGGCAG-3′; Gapdh promoter, 5′-ATCACTGCCACCCAGAAGACTGTGGA-3′ and 5′- CTCATACCAGGAAATGAGCTTGACAAA -3′.
3
Protein Extraction and Western Blotting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total lysates were prepared from cells using NP40 lysis buffer (50 mM Tris-HCL [pH 8.0], 150 mM NaCl, 0.1% SDS, 0.5% SDC, 1% NP40, 0.5 × protease inhibitor cocktail, 1 mM EDTA [pH 8.0]). The lysates were rotated 30 min at 4 ℃, sonicated on ice for 10 s and centrifuged. The lysates were fractionated on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel and transferred to nitrocellulose membranes. The membranes were probed at 4 ℃ overnight with the primary antibodies anti-UHRF1 (1:1000, sc-373750, Santa Cruz), anti-TIP60 (1:500, sc-166323, Santa Cruz), anti-GFP (1:1000, sc-9996, Santa Cruz), anti-mouse IgG (1:1000, sc-2025, Santa Cruz), anti-FLAG® M2 (1:10000, F3165, Sigma), anti-Rabbit IgG (1:5000, 12–370, Merck) and anti-β-actin (1:1000, sc-47778, Santa Cruz). The blots were incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit or goat anti-mouse IgG (1:5000, Enzo Life Sciences) and detected using an ECL system (ABClon).
4
Comprehensive Antibody Validation for Diverse Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antibodies used for western blots (all diluted by 1:2000) include anti-Flag (M2)-HRP (Sigma, A8592), anti-H3 (CST, 9715), anti-GAPDH (CST, 2118), anti-β-Tubulin (CST, 2146), Streptavidin-HRP (CST, 3999) and anti-GFP (CST, 2956). Antibodies used for FACS (all diluted by 1:100) include c-KitAPC (Invitrogen, 17-1172-82), c-KitFITC (eBioscience,11-1171-85), Cd34APC (eBioscience, 50-0341-82), Cd34FITC (BD, 560238), Mac1APC (BD, 557686), Mac1FITC (eBioscience, 11-0112-85), Gr1FITC (eBioscience, 11-5931-85), Cd4FITC (eBioscience,11-0042-82), Cd8aFITC (eBioscience,11-0081-82), and Cd19FITC (eBioscience,11-0193-82). Antibodies used in ChIP, ChIP-seq and CUT&RUN assays include anti-Flag (Sigma, F1804), anti-HA (Abcam, ab9110), anti-GFP (Abcam, ab290), anti‐H3K36me3 (Abcam, ab9050), anti-H3K27ac (Abcam, ab4729), anti‐H3K27me3 (Millipore, 07-449), anti-H4ac (Millipore, 06-866), anti-BRD4 (Bethyl, A301-985A100) and anti-Tip60 (Santa Cruz, sc-166323). 10 ug antibodies were mixed with 100 μl Dynabeads for each ChIP or ChIP-seq assay. All antibodies used in CUT&RUN assays were diluted by 1:100.
5
Evaluating DNA Damage Response in A-T Cells
6
Quantitative Protein Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole cell lysates were obtained by re-suspending cell pellets in RIPA buffer (50 mM Tris pH7.4, 150 mM NaCl, and 1% Triton X-100) with freshly added protease inhibitor (Roche) as previously described (Zeng et al., 2018 (link); Li et al., 2018e (link); Fan et al., 2019 (link)). Nuclear proteins were extracted essentially as described before (Li et al., 2018d (link)). Antibodies were incubated with cell lysates overnight before being absorbed by Protein A/G-plus Agarose beads. Precipitated immune complex was released by boiling with 1X SDS electrophoresis sample buffer. Western blot analyses were performed with anti-MRTF-A (Santa Cruz, sc-32909), anti-Tip60 (Santa Cruz, sc-166323), anti-iNOS (Santa Cruz, sc-651), and anti-β-actin (Sigma, A2228) antibodies. Image J software was used for densitometrical quantification and densities of target proteins were normalized to those of β-actin. Data are expressed as relative protein levels compared to the control group which is arbitrarily set as 1.
7
Antibodies and Reagents for DNA Damage Response
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The antibodies used in the present work were as follows: anti‐Flag (F3165, Sigma‐Aldrich), anti‐Flag@M2 Affinity Gel(AZ220, Sigma), anti‐TIP60 (sc‐166323, Santa Cruz Biotechnology), anti‐SENP3 (ab124790, Abcam), anti‐DNA‐PKcs (ab32556, Abcam), anti‐DNA‐PKcs pT2609 (ab97611) and pS2056 (ab18192) (both Abcam), anti‐ATM (sc‐135663, Santa Cruz Biotechnology), anti‐ATM pS1981 (ab81292, Abcam), anti‐HA (H9658, Sigma), anti‐acetylated‐lysine antibody (9441s, Cell Signaling Technology), anti‐histone H4 (2592) and anti‐CHK2 pT68 (2661) (both Cell Signaling Technology), anti‐H4K16ac (13534s, Cell Signaling Technology), anti‐CHK1 (sc‐8408, Santa Cruz Biotechnology), anti‐CHK1 pS345 (2348s, Cell Signaling Technology), anti‐CHK2 (ab109413, Abcam), anti‐β‐actin (TA‐09, ZSGB‐BIO), anti‐γH2AX(05‐636, EMD Millipore), Alexa Fluor 488‐labelled Goat Anti‐Mouse IgG(H+L)(A‐21202, Invitrogen), Alexa Fluor 568‐labelled Goat Anti‐ Rabbit IgG(H+L) (A‐11036, Invitrogen). Cisplatin (PHR1624), etoposide (E1383), campathecin (C9911) and mitomycin C (M0503) were purchased from Sigma‐Aldrich. Annexin V, FITC Apoptosis Detection Kit (AD10) was purchased from DOjindo.
8
Western Blot and Immunofluorescence Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Western blotting was performed using the antibody recognizing anti-acetyl lysine (Millipore; AB3879), anti-GFP (Roche; 11 814 460 001), Anti-Tip60 (K17, Santa Cruz), Anti-β Tubulin (Ab6046, Abcam), β-actin (Sigma), Cleaved caspase 3 (Asp175) (91164; Cell Signalling), H4K8 (Millipore; 07-328), H4K16 (Millipore; 07-329), H3 (Abcam; AB1791). Immunofluorescent detection of γH2AX was performed using Antibody JBW301 (Millipore) and 53BP1 (Bethyl Laboratories; A300-272A) with a Texas Red and FITC-conjugated secondary antibodies respectively (Jackson Immunoresearch).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!