G50 column

T4 polynucleotide kinase (PNK) (Thermo Fisher Scientific) and γ-³²P-ATP were used to 5′ end label 0.5 μM 10A-G4 oligonucleotides or their mutated variants at 37°C for 75 min. Subsequently, 1 μl 0.5 M ethylenediaminetetraacetic acid (EDTA) was added and the reaction was incubated at 78°C for 1 min to inactivate the T4 PNK. Labeled DNA was purified on a G50 column (GE Healthcare).
To fold the G4 oligonucleotides, 20 μl of labeled 0.2 μM 10A-G4 oligonucleotides, or their mutated variants, was mixed with an equal volume 2 × folding buffer (20 mM Tris (pH 7.5) and 200 mM KCl). The reaction was incubated at 95°C for 5 min and allowed to cool down to room temperature for 3 h. The oligonucleotides were loaded on a 10% native polyacrylamide gel containing 50 mM KCl and separated in a cold ice box run at 100 V for 80 min.

10 µg of purified RNA was resolved by denaturing formaldehyde agarose gel electrophoresis with MOPS buffer. RNA was transferred to Hybond-XL membrane in 1xSSC buffer overnight by capillary transfer. RNA was UV cross-linked to the membrane and pre-hybridised with Expresshyb (CloneTech, Mountainview, CA, USA, 636831) for 2 hr at 65°C. The DNA probe was generated by PCR (primers are shown in Supplementary file 4B) and 25 ng of probe DNA was labelled with [³²P]-dCTP using Radprime DNA labeling system (Thermo Fisher Scientific, 18428–011). The free-nucleotide was removed from labelled probe using G-50 column (GE Healthcare, 27-5330-01), and was heat-denatured followed by snap cooling. The probe was added to the pre-hybridised membrane and incubated overnight at 65°C in a rolling incubator. Membrane was washed with wash buffer containing 0.1 x SSC and 0.1% SDS 3 times at 65°C with 10 min intervals. The membrane was placed in a phosphoimager and exposed for at least overnight at −80°C before scanned using Typhoon 9410 phosphoimager system (GE Healthcare).

Nuclear lysates were prepared as described by Jianping Ye (Pennington Biomedical Research Center, Louisiana State University). Oligonucleotides for m18RE and Sp1 consensus sites can be found in Table 3. Oligonucleotides were labeled with ³²P-y-ATP using T4 kinase (NEB). Probes were purified on a G-50 column (G&E health care, Little Chalfont UK), and incorporated radioactivity was measured using a Beckman LS60001C scintillation counter. 4000cpm of labeled probe were added to nuclear lysates. Where indicated, competing unlabeled DNA probes were included in the reaction at a 1000:1 ratio. For super-shift assay 1ug of indicated Ab was added. Samples were run on a 5% native acrylamide gel. Gels were dried before being exposed in phosphofluor cassettes and analyzed using a Typhoon imager.10.7554/eLife.14749.019Table 3.

EMSA Oligos.

DOI:http://dx.doi.org/10.7554/eLife.14749.019

Primer pair	Forward
m18RE	ggctcgcaggtccacgccccttggcaccggag
m18RE*	ggctcgcaggtccaaaccccttggcaccggag
Sp Consensus	attcgatcggggcggggcgagc
Sp* Consensus	attcgatcggttcggggcgagc

DNA templates for in vitro transcription were amplified using genomic DNA and primer pairs carrying a T7 promoter (Supplementary Table 10). The in vitro transcription reaction was performed using the MEGAscript T7 kit (Thermo Fisher Scientific) followed by DNase I digestion (1 U; 37 °C; 15 min). RNA products were then excised from a 6% (vol vol⁻¹) PAA-7M urea gel by comparison with a Low Range RNA ladder (Thermo Fisher Scientific) and eluted overnight in elution buffer (0.1 M NaOAc, 0.1% sodium dodecyl sulfate and 10 mM EDTA) on a thermoblock at 8 °C and 1,400 r.p.m. The next day, the RNA was precipitated in an ethanol:NaOAc (30:1) mix, washed with 75% ethanol and resuspended in 20 µl water (at 65 °C for 5 min).
Radioactive labelling of the in vitro-transcribed RNA was carried out by dephosphorylating 50 pmol RNA with 25 U calf intestine alkaline phosphatase (NEB) in a 50 µl reaction and incubating at 37 °C for 1 h. The dephosphorylated RNA was extracted using phenol:cholorform:isoamylalcohol (25:24:1) and precipitated as described above. Next, 20 pmol of this RNA was 5′ end-labelled (20 µCi ³²P-γATP) using 1 U polynucleotide kinase (NEB) at 37 °C for 1 h in a 20 µl reaction. The labelled RNA was purified using a G-50 column (GE Healthcare) and extracted from a PAA gel as described above.

To generate a Northern blot probe, PNCTR-specific PCR product amplified with KAPA HiFi polymerase and PNCTR_F5/PNCTR_R5 primers (Table S5) was labeled using [α-32P]-dCTP and Amersham Megaprime DNA Labeling Systems and purified using a G-50 Column (GE Healthcare; cat# 27533001), as recommended. The probe was denatured at 100°C for 5 min and chilled on ice for 2 min immediately before use. Biotin-labeled FISH probe was prepared by incubating 1 μg of the PNCTR FISH probe BAC with 4 μl of 5 × Nick Translation reaction buffer, 0.4 μl of 6 mM dNTP mix, 6 μl 1 mM Biotin-16-dUTP in total volume of 20 μl at 18°C for 2.5 hours. The reaction was stopped by adding 1 μl each of 20% SDS and 0.5 M EDTA followed by a 10-min incubation at 70°C. Labeled DNA fragments were precipitated with 2.5 volumes of ethanol and 0.1 volumes of 3 M sodium acetate (pH 5.2) using 10 μg of salmon sperm DNA (Agilent Technologies; cat# 201190) as a carrier. DNA pellet was washed with 70% ethanol and dissolved in nuclease-free water (Thermo Fisher Scientific, cat# AM9939).

The probe was generated and labeled with [α-³²P]dCTP (deoxycytidine triphosphate) immediately before use and purified by a G50 column (GE Healthcare). gDNA was extracted using the Qiagen gDNA Extraction Kit; 10 μg of gDNA was then digested with 20 U of SphI (NEB). Digested gDNA was run on a 0.8% agarose gel overnight and then transferred to a Hybond-N membrane overnight (GE Healthcare). The membrane was prehybridized in Rapid-Hyb buffer (GE Healthcare) and then hybridized with the radiolabeled probe at 65°C for 4 hours. Following washes with SSC buffer, the membrane was exposed to film overnight at −80°C. WT (no integration) had a 6500–base pair (bp) band compared with CRISPRi integrated lines, which had a 3500-bp band. Primers to generate the probe were AGGTTCCGTCTTCCTCCACT (forward) and GTCCAGGCAAAGAAAGCAAG (reverse).