Pcr xl topo vector
The PCR-XL-TOPO vector is a linear DNA vector designed for the direct cloning of PCR products. It features a single 3' deoxythymidine (T) overhang for efficient ligation of PCR products. The vector also contains the ccdB gene, which enables counterselection of recombinant clones.
Lab products found in correlation
17 protocols using pcr xl topo vector
Cloning Full-Length EV-A71 cDNA
Cloning and Expression of Target Genes
Slit1 Expression in Lentivirus System
Constructing HMA4 Complementation Vector
Promoter Activity Analysis of NF-κB and IL-6
For the analysis of il6 promoter activity, the murine il6 promoter (distal fragment, −1029 to +31; proximal fragment, −649 to +31) was amplified from mouse genomic DNA (Promega) using an LA Taq polymerase (Takara bio) and was subcloned into pCR-XL-TOPO vector (Invitrogen). The subcloned fragments were digested at KpnI/XhoI sites and cloned into pGL3 vector (Promega) at the corresponding sites. The cells were transiently transfected by using a LipofectAMINE Reagent with distal or proximal constructs containing the luciferase reporter gene, and luciferase activity was determined with a Dual Luciferase Assay System Kit (Promega). Activity was normalized relative to an internal cotransfected constitutive control (Renilla luciferase expression vector, pRL-TK vector, Promega), as described [5 (link), 10 (link), 12 (link)].
cis-Regulatory Analysis of lin-39 via Reporter Fusions
The fosmid clone WRM0616aE11 (genomic region: III:7519128..7554793) (Source BioScience) that contains the entire lin-39 locus was linearized by restriction enzyme digestion, mixed with sonicated bacterial genomic DNA (12 ng/µl) and injected into young adult N2 hermaphrodites at 15 ng/µl using myo-2::gfp as co-injection marker (3 ng/µl).
CHIKV PCR Fragment Cloning and Analysis
Tie cDNA Cloning and Transgenic Fly Generation
To clone a Tie cDNA, total RNA was isolated from whole Sevelin pupae 2-3 days post-white pupa stage, reverse transcribed (RT primer: ATGCGCTGCACGCCTAAATCA3), PCR-amplified with tie specific primers (amplification primers:5′
3′
Generating Reporter Gene Fusions for cis-Regulatory Analysis
TREM2 Gene Expression Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!