Hinfi enzyme

Following PCR, the enzymatic digestion was performed with the Hinf I enzyme (New England BioLabs, Inc., Ipswich, MA, USA) for the KRAS-LCS6 polymorphism and with Tai I (New England BioLabs, Inc.,) for the SLC23A2-05 polymorphism, at 37°C for 14 h according to the manufacturer’s instructions.
The reaction was analyzed on a polyacrylamide gel (12%) with a voltage of 180 V for 4 h. The gel was stained in ethidium bromide solution and visualized on a Typhoon™ scanner (GE Healthcare, Wisconsin, WI, USA).
According to the fragments observed, the genotypes were identified as follows: i) KRAS-LCS6 polymorphism; TT (8+80+135+197 bp), TG (8+80+135+197+332 bp), and GG (8+80+332 bp) and ii) SLC23A2-05 polymorphism; CC (385 bp), CG (128+270 bp) and GG (128+270+385 bp).

Genomic DNA was extracted from 5 mL of peripheral whole-venous blood using a salting out procedure, as previously described [24 (link)], and quantified by NanoDrop 2000 (Thermo Fisher Scientific, Inc., Waltham, MA, USA). T399I polymorphism (+1196C/T transition; rs4986791) was typed by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Briefly, the DNA region comprehending the polymorphism was amplified by PCR by using the TLR4 T399I-forward: 5′-GGTTGCTGTTCTCAAAGTGATTTTGGGAGAA-3′ and TLR4 T399I-reverse: 5′-ACCTGAAGACTGGAGAGTGAGTTAAATGCT-3′ primers. Amplifications were carried out in a final volume of 30 μL including 200 ng of DNA template, primers at 500 nM and 1 U of Taq polymerase (Invitrogen, Carlsbad, CA, USA). PCR conditions were as follows: denaturation for 4 min at 95 °C, 35 cycles of 45 sec at 95 °C, 45 sec at 67 °C and 90 sec at 72 °C, followed by 5 min at 72 °C. The specific amplificated band of 406 bp was digested by a HinfI enzyme (New England Biolabs, Ipswich, MA, USA), following the manufacturer’s instructions. PCR-RFLP products were separated upon digestion in 3% NuSieve GTG agarose gels (Lonza Rockland, Rockland, ME, USA) with GelRed Nucleic Acid Gel Stain (Biotium, Fremont, CA, USA) and visualized under Ultraviolet (UV) light by using a ChemiDoc XRS analyzer (Bio-Rad, Hercules, CA, USA).

A fragment of 146 bp from the MTHFR gene containing the C677T SNP was amplified by Polymerase Chain Reaction (PCR) using forward primer (5′TGAAGGAGAAGGTGTCTGCGGGA3′) and reverse primer (5′CCTCACCTGGATGGGAAAGATCC3′) as described previously [28] (link). The PCR product was separated using 2% agarose gel electrophoresis to confirm the correct amplicon size. Overnight restriction digestion of the PCR product was performed at 37°C with HinfI enzyme (New England Biolabs, United Kingdom) according to the supplied protocol. Digestion products were resolved using 4% agarose gel electrophoresis (Figure 1). A few random samples from cases and controls were also tested by Sanger sequencing (Figure 2).