Reverse transcription kit

RNA was extracted and converted to cDNA using a Reverse Transcription Kit (MF011-T, mei5bio). Quantitative PCR (qPCR) was performed on an Applied Biosystems 7500 Real-Time PCR System using SYBR Green qPCR Mix (Selleck, B21703). The primers used for qPCR analysis are provided in Supplementary Table S5. Whole transcriptome sequencing was performed at the Beijing Genome Institute (BGI).

Total RNA was isolated from cultured cell lines using a TRIzol reagent, and reverse transcription was performed to obtain cDNA using a reverse transcription kit (Mei5bio, Beijing, China) according to the manufacturer’s instructions. qRT-PCR analyses were performed with a 20 μL mixture comprising 2 × SYBR Green qRT-PCR Master Mix (Bimake, Shanghai, China) and gene-specific oligonucleotide primers (PLK2, 5′-forward primer: CTACGCCGCAAAAATTATTCCTC, reverse primer: 5′-TCTTTGTCCTCGAAGTAGTGGT; GAPDH, forward primer: 5′-AGAAGGCTGGGGCTCATTTG; reverse primer: 5′-AGGGGCCATCCACAGTCTTC). In the analysis of the data, the relative expression of genes was expressed as 2−ΔΔCt (ΔCt = Ct targeted gene—Ct internal gene; −ΔΔCt = ΔCt control group—ΔCt experimental group).

For analysis of gene expression, total RNA was extracted from cultured cells using the EASY spin Plus Bone Tissue RNA Kit (Aidlab Biotechnologies Co., Ltd., Beijing, China). The cDNA was generated using a reverse transcription kit (Mei5 Biotechnology Co., Ltd., Beijing, China). An SYBR Premix EsTaq reagent (Mei5 Biotechnology Co., Ltd., Beijing, China) was used for real-time PCR by the StepOnePlus real-time PCR system (Applied Biosystems, Waltham, MA, USA). The relative expression was normalized to GAPDH. The primers are shown in Supplementary Table S1.