Allinonecycler

DNA samples of plant materials were prepared at a final concentration of 50 ng/µl following the procedure described by Murray and Thompson (1980 (link)) with minor modifications and treated with RNAse I at 37 °C for 1 h for SNP genotyping. The concentrations of DNA samples were assessed using the Nanodrop ND 1000-spectro-photometer (Thermo Fisher Scientific, Inc., Wilmington, NC, USA) for nucleic acid quantification, and the quality of DNA samples was confirmed by visualization on 1.5% agarose gel. The PCR reaction was performed in an AllInOneCycler (BIONEER, Korea) in a total volume of 25 µl with 10 ng genomic DNA, 0.25–5 µM SSR primer, 200 µM dNTP mix, PCR buffer (containing 50 mM KCl, 10 mM TRIS–Cl (pH 8.3), 3 mM MgCl), and 0.5 U of taq polymerase. The PCR profile was performed at an initial denaturation at 94 °C for 8 min, followed by 32 cycles of denaturation at 94 °C for 30 s, annealing at 55 or 60 °C for 30 s, and extension at 72 °C for 30 s, and a final extension at 72 °C for 8 min.

Primers to genotype the candidate variant were designed using Primer3Plus [47 (link)] (https://primer3plus.com/cgi-bin/dev/primer3plus.cgi) and checked for specificity by a BLAT search against the reference genome (ARS-UCD1.2). The primers Pair1_L (5’GCTTGGGATCTGACAAAGGA3’) and Pair1_R(5’TGGCCTCACGTTCTTCTTCT3’), synthesized at Macrogen Europe, amplified a 382bp fragment. Genomic DNA was extracted from blood samples using DNeasy Blood & Tissue Kit (Qiagen, Germany) according to the manufacturer’s instructions. A 25μl PCR mix was prepared using 12.5μl OneTaq Quick-Load 2X Master Mix (New England Biolabs) with Standard Buffer, 9.5μl of nuclease-free water, 0.5μl of each 10μM primer (Pair1_L and Pair1_R) and 2μl of genomic DNA extract. The PCR was performed using an AllInOneCycler (Bioneer) with the following conditions: initial denaturation at 94°C for 30 seconds; 30 cycles of denaturation at 94°C, annealing at 58°C and extension at 68°C for 30 seconds at each step; the final extension at 68°C for 5minutes. PCR products were sent to Macrogen Europe (Amsterdam, Netherlands) for sequencing.