Sybr green qpcr mix

EASY spin Plus kit (Aidlab, China) and QuantiTect Rev (Vazyme, China) were used to obtain RNA from tissues or cells. Transcription Kit (Vazyme, China) was used to synthesize QuantiTect RevComplementary DNA (cDNA), and cDNA was amplified by SYBR Green qPCR Mix (Vazyme, China) and analyzed by RT-PCR.
Primer list used in this study are as follows:
ITGB3 FORWARD:TCATCTGGAAACTCCTCATCAC
ITGB3 REVERSE:GTAGACGTGGCCTCTTTATACA

Total RNA was extracted from TCam-2 and NTERA-2 cells by using Total RNA Kit (Omega Biotek, China). The mRNA expression was measured in triplicate using SYBR Green qPCR Mix (Vazyme, China) according to the manufacturer’s instructions. Primer sequences were as follows: YAP1: Forward: 5’TAGCCCTGCGTAGCCAGTTA, Reverse: 5’TCATGCTTAGTCCACTGTCTGT. βactin: Forward: 5’TGACGTGGACATCCGCAAAG. Reverse: 5’CTGGAAGGTGGACAGCGAGG. The comparative Ct method was used to calculate the relative mRNA expression, and β-action was used as an internal control.

RNA was extracted from lung adenocarcinoma cell lines (A549, H1299) interfering with si-SMS and NC as controls. SYBR Green qPCR mix (Vazyme, China) was used to synthesize cDNA for real-time PCR. primers were as follows: SMS-Forward: TAGTGGGGATGTAATTTGGCAG; SMS-Reverse: CCACACGTTTTTCGCATGTATTT; GAPDH-Forward: GACCACAGTCCATGCCATCA; GAPDH-Reverse: GTCAAAGGTGGAGGAGTGGG. Protein blotting analysis of RIPA lysis buffer (Servicebio, China) containing PMSF (Servicebio, China) was used to collect proteins from A549 and H1299 cells. 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) was used to separate protein samples, and polyvinylidene difluoride (PVDF) membranes (Immobilon-P, Carlsbad, Ireland) were used to transfer the separated proteins. The closure was performed for 15 min using Rapid Closure Solution, followed by incubation with primary antibodies: SMS (Proteintech, 15979-1-AP, 1:1000) and Vinculin (Proteintech, 66305-1-Ig, 1:50,000) overnight at 4 °C, followed by secondary antibody incubation for 2 h. Original images of the western blot are available in the Supplementary File.

RNA was extracted from gastric cancer cell lines (BGC823,MKN45) interfered with si-GLP2R and NC as control. cDNA was synthesized for real-time PCR adopting SYBR Green qPCR mix (Vazyme, China). The primers are listed as following: GLP2R -Forward: TCC​TGG​AAA​TGT​CTC​TGT​ACC​C; GLP2R—Reverse: GGC​GTT​CTC​TAT​CGT​CTG​CC; GAPDH-Forward:GACCACAGTCCATGCCATCA; GAPDH-reverse:GTCAAAGGTGGAGGAGTGGG.

We used RIPA lysis buffer containing phenylmethanesulfonyl fluoride to collect proteins from U251 and U118 cells. We then separated the proteins by 10% SDS-PAGE and transferred them to a 0.45-µm polyvinylidene fluoride membrane (Millipore, USA). Next, we blocked the membrane with 5% skim milk at room temperature for 1 h and performed immunoblotting using the antibodies indicated hereafter, followed by an enhanced chemiluminescence detection kit (Thermo Fisher Scientific). We used the following antibodies: CD81 mouse monoclonal antibody, 1:000(Proteintech 66866-1-lg);SOX10 rabbit monoclonal antibody, 1:1000 (Abclonal A8655);.nanog rabbit polyclonal antibody, 1:1000 (Proteintech 14295-1-Ap).
We extracted RNA from U87, U251, and U118 cells using si-CD81 and negative control (NC) siRNA as a control. Then, we converted the obtained RNA into cDNA using real-time PCR with a SYBR Green qPCR mix (Vazyme, China) and the following primers:

Total RNA was extracted using Tissue Total RNA Isolation Kit (Vazyme, Nanjing, China), followed by a reverse transcription using HiScript II Reverse Transcriptase (Vazyme, Nanjing, China). SYBR green qPCR Mix (Vazyme, Nanjing, China) was used for the qRT-PCR experiment on the LightCycler^® 96 real-time PCR assay system (Roche, Switzerland). SmUbiquitin served as the reference gene.

TRIzol reagent (Invitrogen, USA) was used for the extraction of total RNA. The purity and concentration of the RNA extracts were successively verified by spectrophotometry (A260/A280 ratio should be between 1.8 and 2.0). The Vazyme HIScript II RT SuperMix for qPCR (+ Gdna wiper) Kit was used for the synthesis of cDNA, and Vazyme SYBR Green qPCRmix was used for qPT-PCR. The 2-ΔΔCt method was applied to analyze the relative expression level which was normalized to GAPDH expression. The primers are shown below:
CCDC69 forward: 5′−CTGTCCAGCTCTGTGCATCAGA − 3′,
CCDC69 reverse: 5′−CTGCTCATCCAGTCTGTCTCGA − 3′.
GAPDH forward: 5′−GGAGCGAGATCCCTCCAAAAT − 3′,
GAPDH reverse: 5′−GCTGTTGTCATACTTCTCATGGG − 3′.