Completely differentiated 3T3-L1 cells were rinsed three times with PBS. After rinsing, the cells were collected using cell scrapers to extract RNA. An RNA isolation kit (Qiagen, Inc., USA) was used to extract RNA with high purity according to the manufacturer’s protocol. The RNA purity was measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific). One microgram of the extracted RNA was used for cDNA synthesis using the Reverse Transcription Master Premix (Elpis-Biotech, Republic of Korea). Gene expression levels were analyzed via real-time RT-qPCR using a LightCycler 480 Instrument II (Roche, Germany). Table 1 presents the primer sequences used. SYBR Mixture (Roche) was used for 45 cycles of RT-qPCR performed on a LightCycler 480 Instrument II (Roche). Gene expression was calculated using the 2−ΔΔCt method. The RT-qPCR cycling conditions were as follows: 5 min at 95°C, 40 cycles of 15 s at 95°C, 15 s at 58°C, and 30 s at 72°C. For relative quantitative analysis, the protein expression level was normalized to that of β-actin, and the gene expression rate was measured by dividing the fold change value of the reference gene.
Lightcycler 480 instrument 2
Manufactured by Roche
Sourced in Switzerland, Germany, United States, China, United Kingdom, Japan, France, Australia
The LightCycler 480 Instrument II is a real-time PCR system designed for high-throughput nucleic acid quantification and gene expression analysis. It features a 96-well format and advanced optical detection system to enable accurate and reliable results.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (109 mentions)
Lightcycler 480 sybr green 1 master, by Roche (52 mentions)
Trizol, by Thermo Fisher Scientific (43 mentions)
Rneasy mini kit, by Qiagen (39 mentions)
Lightcycler 480 sybr green 1 master mix, by Roche (37 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (36 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (36 mentions)
Quantitect reverse transcription kit, by Qiagen (21 mentions)
Primescript rt reagent kit, by Takara Bio (18 mentions)
Rneasy plus mini kit, by Qiagen (15 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (15 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (15 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (14 mentions)
Iscript cdna synthesis kit, by Bio-Rad (13 mentions)
Nucleospin rna kit, by Macherey-Nagel (12 mentions)
Rneasy kit, by Qiagen (12 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (12 mentions)
Random hexamer, by Thermo Fisher Scientific (12 mentions)
High pure rna isolation kit, by Roche (11 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (11 mentions)
766 protocols using lightcycler 480 instrument 2
1
Quantitative Analysis of Gene Expression
2
Evaluating MammaTyper qPCR Reproducibility
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For determining the reproducibility of MammaTyper, two studies were performed on the two compatible qPCR platforms, whereby the experiments were designed according to hierarchy of investigated factors (Study 1: Instrument/site – days – runs – replicates within runs; Study 2: Instrument/site – extraction – run (=days) – replicates within runs). The first study was conducted on four LightCycler 480 instrument II (Roche) devices utilizing pooled RNA extracted from breast tumors. The outset of the second study, conducted on three Versant kPCR Cyclers (Siemens) and one LightCycler 480 instrument II (Roche), was FFPE breast tissue sections and the aim was to investigate pre-analytical factors and variations between qPCR instruments from different suppliers. All operators participated in familiarization runs and were blinded to any characteristic of the test samples which might create anticipation for a specific output. Each sample was tested in triplicates during each run along with the specified positive and negative controls. One, 10 μm-thick tissue section was input for RNA extraction irrespective of tumor surface or tumor cellular content. The results of the two studies have been combined and arranged by qPCR system for presentation purposes.
3
APOE Genotyping for Cerebral Small Vessel Disease
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
APOE ε2 allele has been reported to increase the susceptibility for cerebral small vessel disease ( Groot et al., 2018 ) (link) , ( Gesierich et al., 2016 ) (link). Therefore, to exclude additional potential cerebral small vessel disease risk factors such as an enrichment for APOE ε2 allele we performed APOE genotyping in our CADASIL-like cohort.
APOE genotypes comprising the APOE ɛ 2, ɛ 3 and ɛ 4 alleles, were assayed using LightCycler 480 Instrument II (Roche), as previously described ( Blumenau et al., 2020 ) (link). Briefly, SNP-specific primers and probes were designed by Thermo Fisher (TaqMan genotyping as-says). The polymorphisms distinguish the ɛ 2 allele from the ɛ 3 and ɛ 4 alleles at amino acid position 158 (rs7412) and the ɛ 4 allele from the ɛ 2 and ɛ 3 alleles at amino acid position 112 (rs429358). Taq-Man real-time polymerase chain reaction assays (PCR) consisted in 10 ul of Taqman Universal PCR Master Mix (Thermo Fisher), 0.5 ul of assay, 8.5 ul of water and 1ul of DNA at 20ng/ul. The 20 μl total volume reaction was loaded in 96-well plates and PCR was performed in a LightCycler 480 Instrument II (Roche), using a cycling program of: 95 °C for 10 min; 40 cycles of 95 °C for 15 sec and 60 °C for 1 min. Each sample was run in duplicates. Twelve negative controls (water) were included in each plate and were consistently called correctly.
APOE genotypes comprising the APOE ɛ 2, ɛ 3 and ɛ 4 alleles, were assayed using LightCycler 480 Instrument II (Roche), as previously described ( Blumenau et al., 2020 ) (link). Briefly, SNP-specific primers and probes were designed by Thermo Fisher (TaqMan genotyping as-says). The polymorphisms distinguish the ɛ 2 allele from the ɛ 3 and ɛ 4 alleles at amino acid position 158 (rs7412) and the ɛ 4 allele from the ɛ 2 and ɛ 3 alleles at amino acid position 112 (rs429358). Taq-Man real-time polymerase chain reaction assays (PCR) consisted in 10 ul of Taqman Universal PCR Master Mix (Thermo Fisher), 0.5 ul of assay, 8.5 ul of water and 1ul of DNA at 20ng/ul. The 20 μl total volume reaction was loaded in 96-well plates and PCR was performed in a LightCycler 480 Instrument II (Roche), using a cycling program of: 95 °C for 10 min; 40 cycles of 95 °C for 15 sec and 60 °C for 1 min. Each sample was run in duplicates. Twelve negative controls (water) were included in each plate and were consistently called correctly.
4
KASP Genotyping Assay for SNP Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Detailed KASP assay was used as reported by Agarwal et al.15 (link), and briefly described as follow. Sequences of SNP markers flanking QTL for TSWV on chromosome A01 were converted to KASP markers. The KASP genotyping assay is fluorescence (FRET) based assay that enables identification of biallelic SNPs15 (link). Two allele-specific forward primers along with tail sequences and one common reverse primer were synthesized by LGC Genomics (http://www.lgcgroup.com ) (Supplementary Table S3 ). The reaction mixture was prepared following the manufacturer’s instructions with minor modifications in number of cycles (KBioscience; http://www.lgcgroup.com/products/kasp-genotypingchemistry/#.VsZK7PkrKM8 ). Briefly, KASP assays15 (link) were run with 10 µL final reaction volume containing 5 µL KASP master mix, 0.14 µL primer mix, 2 µL of 10–20 ng/µL genomic DNA, and 2.86 µL of water. The following thermal cycling conditions were used: 15 min at 95 °C followed by 10 touchdown cycles of 20 s at 94 °C and 1 min at 61–55 °C (dropping 0.6 °C per cycle), and then 26 cycles of 20 s at 94 °C and 1 min at 55 °C. For each assay 26 cycles were used. The fluorescent endpoint genotyping method was carried out using Roche Light Cycler 480-II instrument (Roche Applied Sciences, Indianapolis, IN, USA).
5
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was prepared using the RNeasy Plus Mini kit (Qiagen, Valencia, CA, USA) and converted into cDNA using Superscript III Reverse Transcriptase (Invitrogen). Quantitative gene expression analysis (quantitative PCR) was performed with Roche LightCycler 480 SYBRGreen 1 Master Mix (Roche Diagnostics) using the Roche LightCycler 480 II instrument (Roche Diagnostics). The primers utilized were obtained from Integrated DNA Technologies (IDT, Coralville, IA, USA) and are as follows:
(i) Ribosomal protein s14 (Rps14) which was used as a house keeping gene for analysis of OVA expression in lung tissues: 5′-TGACATCCTCAATCCGCCCAATCT-3′ and 5′-CATCACTGCCTTGCACATCAAACT-3′; (ii) OVA: 5′-GTGACTGAGCAAGAAAGCAAACCTG-3′ and 5′-TTGTCCCACTGGCAAATGGAAG-3′; (iii) L19 as a house keeping gene for IL-15 analysis: 5′-CCTGAAGGTCAAAGGGAATGTG-3′ and 5′-GCTTTCGTGCTTCCTTGGTCT-3′ and (iv) IL-15: 5′-AACTGCTTTCTCCTGGAATTG-3′ and 5′-ATGAACATTTGGACAATGCGT-3′.
(i) Ribosomal protein s14 (Rps14) which was used as a house keeping gene for analysis of OVA expression in lung tissues: 5′-TGACATCCTCAATCCGCCCAATCT-3′ and 5′-CATCACTGCCTTGCACATCAAACT-3′; (ii) OVA: 5′-GTGACTGAGCAAGAAAGCAAACCTG-3′ and 5′-TTGTCCCACTGGCAAATGGAAG-3′; (iii) L19 as a house keeping gene for IL-15 analysis: 5′-CCTGAAGGTCAAAGGGAATGTG-3′ and 5′-GCTTTCGTGCTTCCTTGGTCT-3′ and (iv) IL-15: 5′-AACTGCTTTCTCCTGGAATTG-3′ and 5′-ATGAACATTTGGACAATGCGT-3′.
6
Primer Design for ChIP and Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR primers for evaluating ChIP or sequential ChIP assays were designed to amplify 150–200 base pair fragments from the promoter regions as follows: PROX1 (forward: 5’-GACCCCCAGATTCCCAGGTCCTTCT-3’; reverse: 5’-AAGCCAGATTTCTATATTTTTTCTG-3’), PML (forward: 5’-TTTCGGACAGCTCAAGGGAC-3’; reverse: 5’-TTAGTTTCGATTCTCGGTTT-3’), TGFBR2 (forward: 5’-AGCTGTTGGCGAGGAGTTTC-3’; reverse: 5’-AGGAGTCCGGCTCCTGTCCC-3’), and TGFB3 (5’-GGGAGTCAGAGCCCAGCAAA; reverse: 5’-TGGCAACCCTGAGGACGAAG-3’). PROX1 coding sequence region primer (forward: 5’-GAGCCCTGATCAGAGAGCAGGAAA; reverse: 5’-GACTTTGACCACAGTGTCCACAAC). Real-time PCR was carried out using SYBR Green PCR mix (Roche) in Roche LightCycler 480II Instrument.
RNA was isolated using an Ultrapure RNA Kit (CWBIO CW0581), reverse transcribed (Takara), and quantified using SYBR green PCR master mix on a Roche LightCycler 480II. The following primers (5’-3’) were used: VEGF-A (forward: AGGGCAGAATCATCACGAAGT; reverse: AGGGTCTCGATTGGATGGCA), VEGF-B (forward: GAGATGTCCCTGGAAGAACACA; reverse: GAGTGGGATGGGTGATGTCAG), VEGF-C (forward: GAGGAGCAGTTACGGTCTGTG; reverse: TCCTTTCCTTAGCTGACACTTGT), VEGF-D (forward: ATGGACCAGTGAAGCGATCAT; reverse: GTTCCTCCAAACTAGAAGCAGC), vIL-6 (forward: TCGTTGATGGCTGGTAG; reverse: CACTGCTGGTATCTGGAA), and vGPCR (forward: AACCATCTTCTTAGATGATGAT; reverse: AATCCATTTCCAAGAACATTTA).
RNA was isolated using an Ultrapure RNA Kit (CWBIO CW0581), reverse transcribed (Takara), and quantified using SYBR green PCR master mix on a Roche LightCycler 480II. The following primers (5’-3’) were used: VEGF-A (forward: AGGGCAGAATCATCACGAAGT; reverse: AGGGTCTCGATTGGATGGCA), VEGF-B (forward: GAGATGTCCCTGGAAGAACACA; reverse: GAGTGGGATGGGTGATGTCAG), VEGF-C (forward: GAGGAGCAGTTACGGTCTGTG; reverse: TCCTTTCCTTAGCTGACACTTGT), VEGF-D (forward: ATGGACCAGTGAAGCGATCAT; reverse: GTTCCTCCAAACTAGAAGCAGC), vIL-6 (forward: TCGTTGATGGCTGGTAG; reverse: CACTGCTGGTATCTGGAA), and vGPCR (forward: AACCATCTTCTTAGATGATGAT; reverse: AATCCATTTCCAAGAACATTTA).
7
Quantitative Gene Expression Analysis in Watermelon
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Cla009408, Cla006737, Cla006738, Cla001244, Cla006625, Cla009378, Cla009382, Cla007521, and Cla009410 expression patterns were examined by quantitative real-time (qRT)-PCR. The G17AB and “Zhongliu” plants were grown for about 60 days after sowing. Three replicates of the anther samples were collected, each comprising 10 anthers from individual plants. Total RNA was extracted and gene expression was analyzed as previously described (Dong et al., 2018 (link)). Briefly, total RNA was isolated from each sample using the TRIzol reagent (Invitrogen, Carlsbad, CA, United States). qRT-PCR was completed using TB Green® Premix Ex TaqTM II (Tli RNaseH Plus) and the Roche LightCycler 480 II instrument according to the manufacturer’s instructions. The PCR program was as follows: 95°C for 30 s; 40 cycles of 95°C for 5 s and 60°C for 30 s. The ClYLS8 gene was used as an internal reference control. Primers were designed based on the C. lanatus 97,103 genome sequence using the Primer5 program. Details regarding the qRT-PCR primers used to analyze candidate gene expression are listed in Table 1 .
8
Sesame Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA extraction from three tissues (root, stem, and leaves) of control and treatment was performed using the Plant Total RNA Isolation Kit Plus (FOREGENE, China). Subsequently, the PrimeScript™ RT reagent kit (Takara Bio, China) was utilized to reverse transcribe the extracted RNA into cDNA. For qRT-PCR analysis, the Roche LightCycler® 480 II instrument (Roche, Mannheim, Germany) was employed with LightCycler® SYBR GREEN I Master Mix kit (Roche, China). We designed 7 pairs of specific primers (Supplementary Table S1
9
Quantification of Fibronectin Expression
10
Quantifying Circulating circRNA and Cytokine Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Six circRNA and eight cytokine genes were selected to evaluate expression levels by real time‐quantitative PCR (RT‐qPCR). Total RNAs were reverse transcribed into cDNA using a PrimeScript™ RT Reagent kit (Takara, Dalian, China). RT‐qPCR assays were conducted using the SYBR® Green PCR Master Mix (Takara) in a Roche LightCycler 480II instrument (Roche Applied Science, Penzberg, Germany). The dissociation curve was used to estimate the specificity of PCR products. The expression level of circRNAs were normalized to β‐actin (internal standard control) and calculated using the 2 − Δ Δ C t 27 . The significance of gene expression levels was evaluated by Student's t test between CS and TS.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!