All morphological observations were made with a Leica MZ9.5 stereomicroscope. We morphometrically investigated 307 individual workers belonging to 215 collecting events for the eleven newly described species and six redescribed species. Camponotus BLF and the Madagascar Biodiversity Center team (Table 1 ). The material is deposited in the California Academy of Sciences (CAS ), San Francisco, USA. Data for all pinned specimens examined in this study are available on the web portal AntWeb (https://www.antweb.org ) and can be accessed using their unique identifying specimen code (e.g., CASENT0188388 ). Images are linked to their specimens via the unique specimen code affixed to each pin. Type material and samples used in the morphometric analysis are given for each species after "Additional material examined" in the following order: Province, locality name, latitude, longitude, elevation (m), habitat, collector and abbreviation of depository. The most common collectors are abbreviated as follows:
BLF
FGAT
ARA
PSW
MG
Mz9.5 stereomicroscope
Manufactured by Leica
Sourced in Germany, United Kingdom
The MZ9.5 is a stereomicroscope designed and manufactured by Leica. It provides magnification capabilities for detailed visual observation and inspection of specimens. The MZ9.5 features optics that enable stereoscopic viewing, allowing for the perception of depth and three-dimensional images.
Automatically generated - may contain errors
Lab products found in correlation
A601f 2 camera, by Basler (1 mentions)
Myopacer cell stimulator, by IonOptix (1 mentions)
Dm2500 microscope, by Leica (1 mentions)
Axioskop 2 plus microscope, by Zeiss (1 mentions)
Eos 5d mark 4 camera, by Canon (1 mentions)
Mp e 65mm f 2 8 1 5x macro, by Canon (1 mentions)
Macro twin lite mt 26ex rt, by Canon (1 mentions)
Focus v 7, by Adobe (1 mentions)
Coolpix 4500, by Leica (1 mentions)
10 protocols using mz9.5 stereomicroscope
1
Morphometric Analysis of Newly Described Camponotus Ants in Madagascar
2
Cardiac Tissue Mechanics Characterization
3
Transgenic Mice Generation and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All mice were used according to federal guidelines and as approved by the Cleveland Clinic Institutional Animal Care and Use Committee. Reporters and their flanking insulator sequences were excised from the pWHERE plasmid backbone by digestion with PacI. Transgenic mouse founders were generated by standard pronuclear injection of fertilized mouse oocytes from B6SJL hybrid mice and were bred with wild-type 129x C57BL/6J hybrid partners to derive mouse lines. Transgenic founders and progeny were genotyped by PCR using primers matching the pWHERE-specific lacZ sequence (5′: AGTTGAGGCTGACACTGTTGTG; 3′: GTCTCTGAGTTCTCCACACATCTG; 523-bp product). Standard protocols were used to stain whole embryos and postnatal tissues with X-gal and to stain frozen sections of paraformaldehyde-fixed samples with X-gal and nuclear fast red (19 (link),29 (link)). SOX9 immunostaining was performed as previously described (19 (link)), but after X-gal staining. Whole embryos were visualized using an MZ95 stereomicroscope (Leica) and histology sections using a DM2500 microscope (Leica). All images were acquired with a MicroPublisher 5.0 RTV digital camera using QCapture Pro 6.0 software (QImaging). They were processed with Photoshop CS6 (Adobe) software.
4
Genital Musculature in Tephritoidea Flies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The terminology of the genital sclerites mainly follows White et al. (1999) , Kameneva (2000) , Galinskaya (2012) , and Sinclair (2000) .
Musculature of the male genitalia was studied by manually dissecting material (preserved fresh in 70% alcohol) with microknives in water under a Leica MZ95 stereomicroscope. The illustrations were obtained using the image capture function of the Leica MZ95 trinocular head and subsequently processed.
The male genital muscles ofTephritoidea
List of abbreviations:cerc ; epand ; bph ; hypd ; l scl ; l sur ; m sur ; phapod ; sbepand scl ; sec scl ; sur ; 8 stgst ; M1–M19 .
Musculature of the male genitalia was studied by manually dissecting material (preserved fresh in 70% alcohol) with microknives in water under a Leica MZ95 stereomicroscope. The illustrations were obtained using the image capture function of the Leica MZ95 trinocular head and subsequently processed.
The male genital muscles of
List of abbreviations:
– cerci
– epandrium
– basiphallus
– hypandrium
– lateral sclerite of hypandrium
– lateral surstylus
– median surstylus
– phallapodeme
– subepandrial sclerite
– secondary sclerotisation of hypandrial membrane
– surstylus
– 8 syntergosternite
– muscles
5
Seedling Development and Stress Response
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Seedlings of the wild-type and FtsHi mutants were examined using a Leica MZ9.5 Stereomicroscope at days 4, 6, and 8 after germination. Plants grown in the field or exposed to stress conditions were photographed when they were 6 weeks old using a Canon 650D camera.
6
Insect Specimen Preservation and Sorting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples were stored in 80% EtOH in a freezer until the insects from this trap were sorted to ordinal level using a Leica MZ9.5 stereo microscope. After sorting, specimens were transferred into 96% EtOH. The sorting of the ca. 5,000 specimens took about 60 hours, and contained predominantly Coleoptera (ca. 500 specimens), Hymenoptera (ca. 1,500 specimens), and Diptera (ca. 2,000 specimens). These highly represented orders were kept separated while the orders represented by few specimens were combined in groups (Table 1 , Fig 1
7
Histochemical GUS activity assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Detection of GUS activity was performed using 5-bromo-4-chloro-3-indoyl-β-D-glucuronide (X-Gluc) as described in67 (link), with modifications68 (link). Briefly, 4, 7 or 12 dps seedlings were infiltrated into fresh GUS substrate for 5 min (30,000 Pa) and then incubated for 72 h at 37 °C. Seedlings were, washed twice with water and preserved in 1x PBS-50% glycerol at 4 °C until observation under an Axioskop2 plus microscope (Zeiss) or a MZ9.5 stereomicroscope (Leica).
8
Morphological Analysis of Insect Specimens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Morphological terminology follows Anufriev and Emeljanov (1988) and Gnezdilov et al. (2014) . Photographs were taken using a Canon EOS 5D Mark IV camera with the lens Canon-MP-E-65mm f/2,8 1-5x Macro and the flash Canon Macro Twin-Lite MT-26EX-RT. Images were produced using Helicon Focus v. 7.6.4 and Adobe Photoshop СС 2019 software. The genital segments of male specimens examined were macerated in 10% potassium hydroxide (KOH) and figured in glycerine jelly (Brunel Micro Ltd, UK) using a Leica MZ9.5 stereomicroscope with a camera lucida. The map was prepared using Google Earth Pro (version 7.3) with map data sources as attributed in image.
The specimens examined are deposited in University of Delaware, Department of Entomology and Wildlife Ecology, Newark, Delaware, USA (UDCC ); Smithsonian Institution, National Museum of Natural History, Washington, DC (USNM ); Bernice P Bishop Museum of Natural History, Honolulu, Hawaii (BPBM ); and the Zoological Institute of the Russian Academy of Sciences, Saint Petersburg, Russian Federation (ZIN ).
The specimens examined are deposited in University of Delaware, Department of Entomology and Wildlife Ecology, Newark, Delaware, USA (
9
Herbarium-based Study of Central African Flora
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Herbarium material of the following institutions was studied: BR, BRLU, G, K, MO, P, WAG and YA. Descriptive terminology follows Robbrecht (1988) and Anonymous (1962) . Phytogeographical terminology follows White (1979) . Measurements and other given details are based on the study of herbarium specimens, using a Leica MZ95 stereomicroscope, and data derived from field notes. In the descriptions and key, inflorescence size does not include the corollas, and given colours (except flower colour) are for dried material. Inflorescences are described as uniflorous (one flower only), pauciflorous (2 to 9 flowers) or multiflorous (10 to up to 50 flowers). Flowering and fruiting periods are given as cited on the collector’s labels.
Specimens are cited per country, alphabetically by first collector. All cited specimens have been seen. Coordinates are given to minute-level for each specimen. In the specimen citations “sl” and “sd” indicate that collection locality and date, respectively, are missing on the herbarium label. The conservation status was assessed by applying the IUCN Red List Category criteria (IUCN 2012 ) using the Geospatial Conservation Assessment Tools in GeoCAT (Bachman et al. 2011 ). The key covers the countries Nigeria, Cameroon, Equatorial Guinea, Gabon, Congo and D.R.Congo.
Specimens are cited per country, alphabetically by first collector. All cited specimens have been seen. Coordinates are given to minute-level for each specimen. In the specimen citations “sl” and “sd” indicate that collection locality and date, respectively, are missing on the herbarium label. The conservation status was assessed by applying the IUCN Red List Category criteria (IUCN 2012 ) using the Geospatial Conservation Assessment Tools in GeoCAT (Bachman et al. 2011 ). The key covers the countries Nigeria, Cameroon, Equatorial Guinea, Gabon, Congo and D.R.Congo.
10
Stereomicroscopy and SEM Imaging of Insect Specimens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Specimens were examined with a Leica MZ 9.5 stereomicroscope; morphological measurements were taken by using an ocular graticule. Male genitalia were examined after being cleared in a hot 10% KOH solution and then placed on the same card as the specimen in water-soluble dimethyl hydantoin formaldehyde resin (DMHF). Illustrations were made using a drawing tube attached to an Olympus CH-2 compound microscope. SEM micro graphs were taken using a Tescan Lyra3 GMU FIB Scanning Electron Microscope and JEOL JSM-7401F Field Emission Scanning Electron Microscope, and edited with Adobe Photoshop 9.0.2. software. Digital images were taken using a Nikon Coolpix 4500 digital camera attached to a Leica MZ 9.5 trinocular stereomicroscope; images of the same specimen at different focal planes were combined with Helicon Focus 5.2 Pro and edited with Adobe Photoshop 9.0.2. software.
Data from locality labels are cited verbatim for the type specimens only, and comments are placed in square brackets. Separate labels are indicated by double slashes ( // ). Locality data of the specimens from Iran collected by the expeditions of the National Museum in Prague are specifi ed and/or supplemented by coordinates according to HOBERLANDT (1974 HOBERLANDT ( , 1981 HOBERLANDT ( , 1983)) .
The terminology of body setation follows WERNER & CHANDLER (1995) .
The acronyms of the specimen depositories are:
Data from locality labels are cited verbatim for the type specimens only, and comments are placed in square brackets. Separate labels are indicated by double slashes ( // ). Locality data of the specimens from Iran collected by the expeditions of the National Museum in Prague are specifi ed and/or supplemented by coordinates according to HOBERLANDT (1974 HOBERLANDT ( , 1981 HOBERLANDT ( , 1983)) .
The terminology of body setation follows WERNER & CHANDLER (1995) .
The acronyms of the specimen depositories are:
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!