Qscript cdna synthesis kit

Manufactured by Quantabio

Sourced in United States, Israel

The QScript cDNA Synthesis Kit is a reagent kit designed for the reverse transcription of RNA to produce complementary DNA (cDNA) for downstream applications such as real-time PCR, gene expression analysis, and RNA sequencing. The kit contains the necessary components, including a thermostable reverse transcriptase enzyme, to efficiently convert RNA into cDNA.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

QScript microRNA cDNA Synthesis Kit (37 citations) QScript Flex cDNA synthesis kit (23 citations) CDNA synthesis kit (12 citations) QScript™ cDNA kit (10 citations) QScript miRNA cDNA Synthesis Kit (9 citations) QScript kit (6 citations) QScript synthesis kit (5 citations) Quanta qScript mRNA cDNA Synthesis Kit (3 citations) QScript miR cDNA synthesis kit (2 citations) Quanta qScript cDNA Synthesis Kit (2 citations)

406 protocols using qscript cdna synthesis kit

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated through a phenol:chloroform phase separation protocol as detailed in the TRIzol Reagent User Guide. RNA concentrations were measured by NanoDrop (Thermofisher, MA). 1,000ng of cDNA was synthesized using the qScript cDNA Synthesis kit (QuantaBio, MA) as detailed in the qScript cDNA Synthesis kit Manual. Exon-exon-spanning primers targeting as many splice variants as possible were designed with Primer-BLAST (National Center for Biotechnology Information, MD). qPCRs were performed in triplicate with 30 ng of cDNA and a master mix of exon-spanning primers (Supplementary Table 1) and PerfeCTa SYBR Green FastMix ROX (QuantaBio, MA) on an QuantStudio real-time PCR analyzer (Invitrogen, MA), and results were expressed as fold change (2^−ΔΔCt) relative to the β-actin gene (Actb).

Serafini R.A., Frere J.J., Zimering J., Giosan I.M., Pryce K.D., Golynker I., Panis M., Ruiz A., tenOever B, & Zachariou V. (2022). SARS-CoV-2 Airway Infection Results in Time-dependent Sensory Abnormalities in a Hamster Model. bioRxiv.

+ Open protocol

+ Expand

Quantitative RT-PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated through a TRIzol:chloroform phase separation protocol as detailed in the TRIzol Reagent User Guide. RNA concentrations were measured by NanoDrop (Thermofisher, MA). 1,000ng of cDNA was synthesized using the qScript cDNA Synthesis kit (QuantaBio, MA) as detailed in the qScript cDNA Synthesis kit Manual. Exon-exon-spanning primers targeting as many splice variants as possible were designed with Primer-BLAST (National Center for Biotechnology Information, Maryland, USA). qPCRs were performed in triplicate with 30 ng of cDNA and a master mix of exon-spanning primers (table S1) and PerfeCTa SYBR Green FastMix ROX (QuantaBio, MA) on an QuantStudio real-time PCR analyzer (Invitrogen, MA), and results were expressed as fold change (2^-ΔΔCt) relative to the β-actin gene (Actb).

, & Levite M. (1998). Neuropeptides, by direct interaction with T cells, induce cytokine secretion and break the commitment to a distinct T helper phenotype. Proceedings of the National Academy of Sciences of the United States of America, 95(21), 12544-12549.

+ Open protocol

+ Expand

Diaphragm RNA Extraction and qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

We retrieved diaphragm samples from Tissue-Tek OCT freezing medium (Sakura Finetek, Torrance, CA) in sterile PBS and homogenized them in TRI-Reagent (Sigma Aldrich, St. Louis, MO) using stainless steel beads and a bullet blender (Next Advanced, Troy, NY). We isolated RNA by using the Direct-Zol RNA Microprep kit (Zymo Research, Irvine, CA). We assessed RNA quantity and quality with UV spectroscopy (Thermo Fisher, Waltham, MA), then generated cDNA using the Quantabio qScript cDNA synthesis kit (Quantabio, Beverly, MA). Real-time PCR was performed on a Quantstudio 3 thermocycler (Thermo Fisher, Waltham, MA) using Taqman Universal Master Mix II and Taqman probes (all from Thermo Fisher, Waltham, MA) for Nox4 (Mm00479246_m1), Fbxo32 (Mm00499523_m1; MAFbx/atrogin-1), and Trim63 (Mm01185221_m1; MuRF-1). Results were normalized to HPRT (Mm00446968_m1) and gene expression was calculated relative to the WT-Sham group using the ΔΔCT method.

Hahn D., Kumar R.A., Muscato D.R., Ryan T.E., Schröder K, & Ferreira L.F. (2021). Nox4 knockout does not prevent diaphragm atrophy, contractile dysfunction, or mitochondrial maladaptation in the early phase post-myocardial infarction in mice. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 55(4), 489-504.

+ Open protocol

+ Expand

Quantifying Cellular mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from TM cells with different EV treatments using an EZ-RNA Kit (Biological Industries, Beit Haemek, Israel) according to the manufacturer’s instructions. RNA quality and quantity were assessed at 260 nm using a NanoDrop2000 Spectrophotometer (Thermo Scientific, Waltham, MA, USA). Equal amounts (1 µg) of RNA were reverse transcribed in triplicates using Quanta bio qScript cDNA Synthesis kit (QuantaBio, USAerly, MA, USA). Changes in mRNA levels of SMAD7, TGFβ2, GSK-3β, and β-Catenin genes were determined by qRT-PCR with an Applied Biosystems Real-Time PCR QuantStudio™ 1 System (Version 1.5.1), using Syber Green Master Mix (Applied Biosystems, Waltham, MA, USA). The human GAPDH gene was used as endogenous control. The mRNA levels were calculated using QuantStudio Design & Analysis Software (Applied Biosystems, Version 1.4). All primers were purchased from IDT (Integrated DNA Technologies, Redwood City, CA, USA), and their sequences are detailed in Table 4.

Tabak S., Feinshtein V., Schreiber-Avissar S, & Beit-Yannai E. (2021). Non-Pigmented Ciliary Epithelium-Derived Extracellular Vesicles Loaded with SMAD7 siRNA Attenuate Wnt Signaling in Trabecular Meshwork Cells In Vitro. Pharmaceuticals, 14(9), 858.

+ Open protocol

+ Expand

RNA Isolation and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using Total RNA Mini Plus (A&A Biotechnology, Gdańsk, Poland). Complementary DNA (cDNA) was synthetized using qScript^TM cDNA Synthesis Kit (Quantabio, Beverly, MA, USA). SYBR Green real time—PCR was carried out according to the manufacturer’s instructions (Applied Biosystems, Waltham, MA, USA). qPCR signals (cT) in each experimental group were normalized to GAPDH levels.

Roncato F., Regev O., Feigelson S.W., Yadav S.K., Kaczmarczyk L., Levi N., Drago-Garcia D., Ovadia S., Kizner M., Addadi Y., Sabino J.C., Ovadya Y., de Almeida S.F., Feldmesser E., Gerlitz G, & Alon R. (2021). Reduced Lamin A/C Does Not Facilitate Cancer Cell Transendothelial Migration but Compromises Lung Metastasis. Cancers, 13(10), 2383.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Isolated RNA was reverse transcribed into cDNA using the qScript^TMcDNA Synthesis kit according to the manufacturer’s instructions (QuantaBio). Quantative PCR (qPCR) was performed on a QuantStudio^TM 6 Flex or QuantStudio^TM 7 Flex (Life Technologies) using SYBR^TM Select Master Mix (Applied BioSystems) with select primers (Table S2). Gene expression was normalized to Ppia for all data sets. Oligonucleotide sequences are provided in Supplementary Table 2.

Murray M.H., Valfort A.C., Koelblen T., Ronin C., Ciesielski F., Chatterjee A., Veerakanellore G.B., Elgendy B., Walker J.K., Hegazy L, & Burris T.P. (2022). Structural basis of synthetic agonist activation of the nuclear receptor REV-ERB. Nature Communications, 13, 7131.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated manually using TRI Reagent® (MRC, OH, USA). cDNA was prepared from total RNA (1 µg) using Quantabio, and a qScript^TM cDNA synthesis kit and PerfeCTa SYBR Green SuperMix were used for qPCR according to the manufacturer’s instructions (Quantabio, MA, USA). To prepare DNA-free RNA samples, RNA was treated with PerfeCTa® DNase I according to the manufacturer’s instructions (Quantabio, MA, USA). A StepOne Plus Real-Time PCR apparatus with StepOne Software v2.3 was used for analysis (Applied Biosystems, MA USA). Each experiment was performed in multiple technical duplications (n > 4) with in 4 biological repeats. Relative mRNA expression was analyzed according to the 2^(−ΔΔCt) calculation method.

Kumar V., Sabaté-Cadenas X., Soni I., Stern E., Vias C., Ginsberg D., Romá-Mateo C., Pulido R., Dodel M., Mardakheh F.K., Shkumatava A, & Shaulian E. (2024). The lincRNA JUNI regulates the stress-dependent induction of c-Jun, cellular migration and survival through the modulation of the DUSP14-JNK axis. Oncogene, 43(21), 1608-1619.

+ Open protocol

+ Expand

Gene Expression Analysis by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction from cells was carried out using GenElute™ Total RNA Purification Kit (Sigma, RNB100-50RXN). RNA was then reverse-transcribed into cDNA using qScriptTM cDNA Synthesis Kit (Quanta-bio, 95047-100). Real-Time PCR (RT-qPCR) reactions were performed using Fast SYBR Green Master Mix (Applied Biosystem, 4385614) in an ABI Step-One Plus Real-Time PCR system. All primers were verified by standard curve evaluation and are shown in Table S8. Primers for expression analysis were designed on exon-exon junctions and a -RT control was performed each time. Relative mRNA fold change was calculated with the ΔΔCT method, using 1-2 control genes (PSMB2 and RPS9) as reference.

Ribarski-Chorev I., Schudy G., Strauss C, & Schlesinger S. (2023). Short heat shock has a long-term effect on mesenchymal stem cells’ transcriptome. iScience, 26(8), 107305.

+ Open protocol

+ Expand

Cholangiocyte Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primary cholangiocytes or SBECs (3 × 10 5 cells in 2 ml per well in 6 well plates) were plated at 37 °C to allow cell adhesion. Cells were treated with either biliatresone/DMSO for 6 h or biliatresone for 6 h followed by a 24 h washout. Total RNA from the cells was extracted with the EZ-10 DNAaway RNA Mini-Preps Kit (Bio Basic, catalog # BS88133) according to the manufacturer's protocol. cDNA was prepared using a qScript TM cDNA Synthesis kit (Quantabio, Beverly, MA). Primer sets for:
RhoU (TGTCTGTAGATGGGCGGCCTGT, TTCTGGAAGGATGTGGGGCTCA), Nf2 (ATAAAAAGGGCACAGAGTTG, AATAGTAAACTCCTTGTCGC), Amotl1 (AAAGTTGGAAATGGAGTTGG, CTTCTCTCGTAACTCTTCCTC), Wnt11 (CCAATAAACTGATGCGTCTAC, ATTTACACTTCGTTTCCAGG), Pard6G (CTGTGAATGATGAAGTCCTG, GTTGGCTATCATCATGTCTG) and Rp13a (AGGGGCAGGTTCTGGTATTG, TGTTGATGCCTTCACAGCGT) were used. Rp13a was our endogenous control. Real-time quantitative PCR was performed using the StepOnePlus real-time PCR system. Expression analysis was done using the double delta ct method as previously described 14 .

Fried S., Har-Zahav A., Hamudi Y., Mahameed S., Mansur R., Dotan M., Cozacov T., Shamir R., Wells R.G, & Waisbourd-Zinman O. (2024). Biliary atresia: insights into mechanisms using a toxic model of the disease including Wnt and Hippo signaling pathways and microtubules. Pediatric research.

+ Open protocol

+ Expand

Metabolic Reprogramming in TNBC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

TNBC cells that were continuously treated by TNFα + IL-1β/vehicle were cultured overnight in complete media supplemented with TNFα + IL-1β/vehicle. Then, the media were replaced by fresh DMEM containing 0.5% FBS, the glycolysis inhibitor 2-DG or the OXPHOS inhibitors Rot+AA (concentrations as in ELISA assays), without TNFα + IL-1β/vehicle. Control cells were supplemented with the inhibitor solubilizer. After 2 h, TNFα + IL-1β/vehicle were added to the cells without a wash, for 6 h. RNA was extracted using EZ RNA extraction kit (#20-400-100, Biological Industries). RNA samples were used to synthesize complementary cDNA using qScript^TM cDNA synthesis kit (#95047, Quantabio, Beverly, MA, USA). The samples were analyzed using iTaq™ Universal SYBR^® Green Supermix (#1725124, BIO-RAD, Hercules, CA, USA) in CFX connect real-time PCR system with primers indicated in Table S1.

Morein D., Rubinstein-Achiasaf L., Brayer H., Dorot O., Pichinuk E., Ben-Yaakov H., Meshel T., Pasmanik-Chor M, & Ben-Baruch A. (2021). Continuous Inflammatory Stimulation Leads via Metabolic Plasticity to a Prometastatic Phenotype in Triple-Negative Breast Cancer Cells. Cells, 10(6), 1356.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!