Total RNA was isolated from cells and tissues using TRIzol (Thermo, Waltham, MA, USA), cDNA was reverse transcribed using TranScript First-Strand cDNA Synthesis SuperMix (Transgen Biotech, Beijing, China), and qPCR was performed using TransScript® II Green One-Step qRT-PCR SuperMix (Transgen Biotech) and CFX-96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, China). The expression of various genes was defined based on threshold cycle (Ct) and calculated using 2−∆∆Ct method. GAPDH was used as the endogenous control. Several primers were shown as follows: TRIM31, forward: 5′-CCAGAGTCAAACCGTGAGCG-3′ and reverse: 5′-GGCAACTTGGAGCCCGAA-3′; BCL2L1, forward: 5′-TCCCCATGGCAGCAGTAAAG-3′ and reverse: 5′-GTGATGTGGAGCTGGGATGT-3′; Snail, forward: 5′-GAC CAC TAT GCC GCG CTC TT-3′ and reverse: 5′-TCG CTG TAG TTA GGC TTC CGA TT3-′; MMP3, forward: 5′-GAGGACACCAGCATGAACCT-3′ and reverse: 5′-CACCTCCAGAGTGTCGGAGT-3′; IL8, forward: 5′-TCTGCAGCTCTGTGTGAAGG-3′ and reverse: 5′-TGGGGTGGAAAGGTTTGGAG-3′; GAPDH, forward: 5′-AAGAAGGTGGTGAAGCAGGC-3′ and reverse: 5′-TCCACCACCCAGTTGCTGTA-3′.
Transcript first strand cdna synthesis supermix
Manufactured by Transgene
Sourced in China
Transcript First-Strand cDNA Synthesis SuperMix is a reagent used for the reverse transcription of RNA into complementary DNA (cDNA). It provides all the necessary components for efficient first-strand cDNA synthesis in a single, ready-to-use solution.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Sybr premix ex taq kit, by Takara Bio (2 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (1 mentions)
Transscript 2 green one step qrt pcr supermix, by Transgene (1 mentions)
Gel logic 200 imaging system, by Kodak (1 mentions)
Transzol up reagent, by Transgene (1 mentions)
Transstart tip green qpcr supermix, by Transgene (1 mentions)
Lightcycler 480 platform, by Roche (1 mentions)
Rnasimple total rna kit, by Tiangen Biotech (1 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Sv total rna isolation system, by Promega (1 mentions)
Dna extraction kit, by Solarbio (1 mentions)
Sybr green rt pcr kit, by Transgene (1 mentions)
Sybr green pcr supermix kit, by Transgene (1 mentions)
Bulge loop mirna qrt pcr detection kit, by RiboBio (1 mentions)
Dulbecco s modified eagle s medium dmem, by Thermo Fisher Scientific (1 mentions)
Protein marker, by Thermo Fisher Scientific (1 mentions)
D glucose, by Merck Group (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
12 protocols using transcript first strand cdna synthesis supermix
1
Quantitative Gene Expression Analysis
2
Adipogenic Gene Expression in 3T3-L1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from adherent cultured 3T3-L1 cells using TRIzol reagent. cDNA was synthesized using transcript first-strand cDNA synthesis super mix (AT301-02, TransGen Biotech, Beijing, China). For PCR amplification of the cDNA products, the following primer pairs were used: PPARγ forward 5′-
GTGCCAGTTTCGATCCGTAGA-3′ and PPARγ reverse 3′-
GGCCAGCATCGTGTAGATGA-5′; adiponectin forward 5′-
GCACTGGCAAGTTCTACTGCAA-3′ and adiponectin reverse 3′-
GTAGGTGAAGAGAACGGCCTTGT-5′; GAPDH forward 5′-
TGAA CGGGAAGCTCACTGG-3′ and GAPDH reverse 3′-
TCCACCACCCTGTTGCTGTA-5′; and C/EBPα forward 5′-
GGTGCGTCTAAGATGAGGGA-3′ and C/EBPα reverse 3′-
CCCCC TACTCGGTAGGAAAA-5′. PCR was performed using a GenePro PCR System (Hangzhou, China). PCR products were electrophoresed by 1% agarose gel electrophoresis and visualized using a Kodak Gel Logic 200 imaging system and the Gene Snap program (Rochester, NY, USA). GAPDH was used as an internal control. The cDNAs were analyzed using the Power SYBR Green PCR kit (04913850001, Roche Diagnostics, Indianapolis, IN, USA) on the ABI StepOne qPCR instrument (Applied Biosystems, Waltham, MA, USA). Each cDNA was amplified (95 °C for 5 s, 58–64 °C for 10 s and 72 °C for 20 s for 40 cycles). All reactions were performed in triplicate, and the data were normalized to GAPDH as an internal control.
GTGCCAGTTTCGATCCGTAGA-3′ and PPARγ reverse 3′-
GGCCAGCATCGTGTAGATGA-5′; adiponectin forward 5′-
GCACTGGCAAGTTCTACTGCAA-3′ and adiponectin reverse 3′-
GTAGGTGAAGAGAACGGCCTTGT-5′; GAPDH forward 5′-
TGAA CGGGAAGCTCACTGG-3′ and GAPDH reverse 3′-
TCCACCACCCTGTTGCTGTA-5′; and C/EBPα forward 5′-
GGTGCGTCTAAGATGAGGGA-3′ and C/EBPα reverse 3′-
CCCCC TACTCGGTAGGAAAA-5′. PCR was performed using a GenePro PCR System (Hangzhou, China). PCR products were electrophoresed by 1% agarose gel electrophoresis and visualized using a Kodak Gel Logic 200 imaging system and the Gene Snap program (Rochester, NY, USA). GAPDH was used as an internal control. The cDNAs were analyzed using the Power SYBR Green PCR kit (04913850001, Roche Diagnostics, Indianapolis, IN, USA) on the ABI StepOne qPCR instrument (Applied Biosystems, Waltham, MA, USA). Each cDNA was amplified (95 °C for 5 s, 58–64 °C for 10 s and 72 °C for 20 s for 40 cycles). All reactions were performed in triplicate, and the data were normalized to GAPDH as an internal control.
3
Transcriptional Analysis of Tea Plant
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TransZol Up Reagent (TransGen Biotech, Beijing, China). The RNA integrity was checked by gel electrophoresis and micro-ultraviolet spectrophotometry (Nanodrop). Then, total RNA was reverse transcribed into first-strand cDNA quantitative real-time polymerase chain reaction (qRT-PCR) using a Transcript First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). The qRT-PCR was performed using the LightCycler 480 platform (Roche Applied Sciences, Basel, Switzerland) with TransStart Tip Green qPCR SuperMix (TransGen Biotech, Beijing, China). The qRT-PCR procedure and reaction system were both used in the previous method (Guo et al., 2019 (link)). The glyceraldehyde-3-phosphate dehydrogenase and β-actin genes were used as reference genes. The transcript abundance was calculated using the 2−ΔΔCt method (Livak & Schmittgen, 2001 (link)), and all primers used for qRT-PCR were designed using the Tea Plant Information Archive platform (Xia et al., 2019 (link)) (Table S2 ). All qRT-PCR analyses were performed in three biological replications, respectively. Statistical analyses were conducted using SPSS 25 software, and the data were analyzed by one-way analysis of variance followed by Tukey’s post-hoc test.
4
Quantifying GPR34 Expression in Glioma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from brain tissues and glioma cells using TRIzol reagent (Invitrogen, Waltham, MA, USA) and reverse transcribed into cDNA using Transcript First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). qPCR was performed using Biosystem SYBR Green Master Mix (Toyobo, Japan). All specific primers in this research were designed and synthesized by Sangon Biotech Co., Ltd (Shanghai, China). The primer sequences for GPR34 amplification were 5′-CGACAACTTCAGTCAGCAGCTG-3′ (forward) and 5′-GGTTGGTCGCTATGATTGGTTA-3′ (reverse). GAPDH, 5′-CGGAGTCAACGGATTTGGTCGTATTGG-3′ (forward) and 5′-GCTCCTGGAAGATGGTGATGGGATTTCC-3′(reverse). Each reaction was performed in triplicate. The mRNA level of GPR34 was normalized to that of GAPDH and calculated using the comparative cycle threshold (2–ΔΔCT) method.17 (link)
5
Nucleic Acid Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from the reference viruses with an RNAsimple Total RNA kit (Beijing Tiangen Biotech Company, Beijing, China) in accordance with the manufacturer’s instructions. DNA was extracted from PPV, PRV, and PCV-2 with a TIANamp Virus genomic DNA/RNA kit (Beijing Tiangen Biotech Company, Beijing, China). cDNA synthesis was performed using the TranScript Firststrand cDNA Synthesis SuperMix (Beijing TransGen Biotech Company, Beijing, China). DNA and cDNA were stored at −20 °C.
6
Real-Time PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The technique of real-time PCR has been reported previously [15 (link), 16 (link)]. Briefly, total RNA of PIECs was extracted with TRIzol® Reagent (Invitrogen). The cDNA samples were synthesized with Transcript First-Strand cDNA Synthesis SuperMix (TransGene Biotech, Beijing, China). The levels of the genes of interest were quantified using SYBR Premix Ex Taq kit (Takara Bio, Dalian, Liaoning, China). The expression levels of the genes were calculated by the 2-ΔΔCt method and normalized to pig glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Amplification of cDNA was performed on a ViiA 7 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) with the sequences of oligonucleotide primers shown in Additional file 1 : Table S1.
7
Quantitative Analysis of Lung Tissue Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of lung tissues was extracted with the SV total RNA isolation system (Promega Corporation, Madison, WI, USA) according to the manufacturer’s protocol. Reverse transcription was used Transcript First-strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). The DNA was extracted from lung with Solarbio DNA extraction kit (Beijing Solarbio Science & Technology Co. Ltd., Beijing, China). DNA or cDNA was synthesized using with a SYBR Green RT-PCR Kit (TransGen Biotech) for collagen I, collagen III, FN, Sry, AQP-5, and SP-C. The sequences of specific primers were presented in Table 1 . The cycling conditions for qPCR were 94 °C for 30 s, followed by 40 cycles of 94 °C for 5 s, 60 °C for 15 s, and 72 °C for 10 s.
Primer sequences for qPCR
| Gene name | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| Collagen I | CAATGGCACGGCTGTGTGCG | CACTCGCCCTCCCGTCTTTGG |
| Collagen III | TGAATGGTGGTTTTCAGTTCAG | GATCCCATCAGCTTCAGAGACT |
| FN | TGACAACTGCCGTAGACCTGG | TACTGGTTGTAGGTGTGGCCG |
| AQP-5 | AAGGAGGTGTGCTCCCTTGCC | TCAGTGTGCCGTCAGCTCGAT |
| SP-C | GTCCTTGTCGTCGTGGTGAT | AGGTAGCGATGGTGTCTGTGT |
| Sry | CATCGAAGGGTTAAAGTGCCA | ATAGTGTGTAGGTTGTTGTCC |
| β-Actin | GTCAGGTCATCACTATCGGCAAT | AGAGGTCTTTACGGATGTCAACGT |
qPCR quantitative real-time PCR, FN fibronectin, Sry sex-determining region Y, AQP-5 aquaporin-5, SP-C surfactant protein-C
8
Circulating miRNA Quantification via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two microgram of total RNA was reverse-transcribed using Transcript First-strand cDNA synthesis SuperMix (TransGen Biotech, Beijing, China) according to the manufacturer's protocol. Briefly, 50 µL reagents were incubated for 60 min at 42°C, 10 min at 70°C, and then preserved at 4°C. The Bulge-Loop miRNA qRT-PCR Detection Kit (Ribobio Co., Guangzhou, China) and SYBR Green PCR SuperMix Kit (TransGen Biotech, Beijing, China) were used in real-time PCR for examining the relative quantification of circulating miRNAs according to the manufacturer's protocol with the Rotor-Gene 6000 system (Corbett Life Science, QIAGEN, Hilden, Germany). U6 was measured as endogenous control for normalizing the date of experimental qRT-PCR. Each specimen was measured in triplicate. The threshold cycle (Ct) value was defined as the cycle number at which the fluorescence signals passed the fixed threshold. In our experiment, the detection limit of Ct value was defined as 40 [32] (link), [33] (link), [45] (link).
9
Quantitative PCR Analysis of Differentially Expressed miRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qPCR was performed to assess the relative expression of the top eight DEMs that were identified in the exploration stage. Total RNA was reverse transcript into cDNAs using Transcript First-strand cDNA synthesis superMix (TransGen Biotech, Beijing, China). Following that, SYBR Premix Ex Taq kit (Takara, Dalian, China) was used for the detection of DEMs. U6 was used as an internal reference, and then, the relative expression of eight DEMs was calculated using 2−ΔΔt method. The primer sequences have been listed in Supplementary Table S1 .
10
Recombinant DNA Methyltransferase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA methyltransferase recombinant protein was purchased from R&D system (USA). Trizol reagent was purchased from Invitrogen (Carlsbad, USA). Fetal bovine serum (FBS, Gibco, USA), dulbecco’s modified eagle’s medium (DMEM, Gibco, USA), and HRP-goat-anti-mouse IgG were purchased from Santa Cruz (USA). Protein marker was purchased from Fermentas (Canada). BCA protein kit was purchased from Pierce (Rockford, USA). ECL luminescence reagent was purchased from Applygen (China). Nitrocellulose filter membrane was purchased from Millipore (Beijing, China). d -Glucose was purchased from Sigma-Aldrich (St. Louis, MO, USA). Transcript first-strand cDNA synthesis supermix was purchased from TransGen Biotech (China). Evagreen qPCR Master Mix was purchased from Applied Biological Materials (ABM) Inc. (Vancouver, Canada). CCK-8 kit was purchased from Sangon (Shanghai, China). Lipofectamine 2000 was purchased fromThermo Fisher (USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!