Pfuse higg1 fc2

Full-length human LRP6, ICAM-1, or EphA2 cDNA cloned into pCMV-Entry (Origene) were used for sub-cloning or transient transfection. pFUSE-hIgG1-Fc2 (InvivoGen) was used for Fc-fusion constructs of truncated LRP6E1E2 and LRP6E3E4 domains. For bispecific tandem scFv-Fc constructs, pFUSE-hIgG1-Fc2 vector was modified by inserting a (G₄S)₅ linker between two scFv fusions. IgG-Abvec plasmids (Ig-γ and Ig-λ) were kindly provided by Dr. Patrick Wilson at University of Chicago^{56 (link)}. The β-catenin-responsive luciferase reporter SuperTopFlash (STF) and the internal control pRL-SV40 Renilla luciferase constructs (Addgene) were used for STF reporter assays. To provide Wnt ligands in STF reporter assays, pcDNA-Wnt1 or -Wnt3a expression plasmid (Addgene) was utilized for transient transfections.

The codon-optimized SARS-CoV-2 rbd gene (N₃₃₄ –K₅₂₉, accession No. QHD43416.1) with (G₄S)₃-linker was synthesized (Twist Bioscience, USA) and inserted into pFUSE-hIgG1-Fc2 (InvivoGen, USA) at EcoRI and BglII restriction sites. The insert was located between IL2 signal sequence and human IgG1 Fc gene. The expression plasmid amplified in E. coli was extracted for transfection using QIAGEN Plasmid Maxi Kit (Qiagen, Germany). DNA concentration and quality were measured and assessed using Nanodrop One microvolume UV-Vis Spectrophotometer (Thermo Fisher Scientific, USA).

Human NLRR1 (NM_020873) tagged with HA at the C-terminal was cloned into the BamHI/NotI site of pcDNA3.1-myc-His (Invitrogen). This construct was used to generate other NLRR1-related plasmids. For secretion of the intact NLRR1 ectodomain, the corresponding PCR-amplified fragment of the intact extracellular region (exN1: M1-L632) was inserted into the BamHI/XhoI site of the pSecTag2B vector (Invitrogen). To fuse exN1 with human placental alkaline phosphatase (AP: NM_001632), the PCR fragment of AP (I18-G489) were inserted into the C-terminal of the pSecTag2B-exN1 vector using the In-Fusion cloning technique (Clontech). To generate the Fc chimeric proteins, intact exN1 and its deletion mutants (exN1-Fc: M1-L632; ΔLRR-Fc: N362-L632; ΔL-Ig-Fc: V516-L632) were introduced into the EcoRI site of pFUSE-hIgG1-Fc2 (Invivogen). The pEGFP-N1 plasmid was employed for EGFP-expressing cells. Expression vectors for WT ALK and ALK F1174L were kind gifts from Dr. Junko Takita (The University of Tokyo, Tokyo, Japan). The ALK R1275Q construct was generated using site-directed mutagenesis. Mission short hairpin RNA constructs, NM_020873.3-427s1c1, NM_020873.3-846s1c1, and NM_020873.3-1359s1c1, were purchased from Sigma.

The following overlapping DNA oligonucleotides encoding peptides were made and HPLC purified by Eurofins Genomics (Ebersberg, Germany).
WN-Fc-1 peptide (WNLPWYYSVSPT) 5′-aattcgtggaatcttccttggtattatagcgtcagtcctacgggtggaggca-3′ 5′-gatctgcctccacccgtaggactgacgctataataccaaggaagattccacg-3′ WN-Fc-2 peptide (WNLPWYYSVSPTGGGWNLPWYYSVSPT) 5′-aattcgtggaatcttccttggtattatagcgtcagtcctacgggtggaggctggaa tcttccttggtattatagcgtcagtcctacgggtggaggca-3′ 5′-gatctgcctc cacccgtaggactgacgctataataccaaggaagattccagcctccacccgtagga ctgacgctataataccaaggaagattccacg-3′ Fc control peptide (ISAMVRS) 5′-aattcgatatcggccatggtta-3′ 5′-aattcgatatcggcc atggtta-3′
DNA oligonucleotides were annealed together to form a double stranded sequence with overhanging bases for EcoR1 and BglII restriction sites and then cloned into EcoR1-BglII-cleaved pFuse-hIgG1-Fc2 vector in frame with IL-2 signal sequence and the Fc portion of human IgG1 (In vivoGen, San Diego, CA, USA). Recombinant peptide Fc fusion proteins were produced by transient transfection of the plasmids into HEK293T cells and purified by protein G chromatography. Protein purity was determined by electrophoresis on 10% sodium dodecyl sulfate (SDS) polyacrylamide gel and positive fractions were collected, pH adjusted to 7.5 and then stored at −80°C until use.

The generation of Fc-fusion proteins for mouse Clec7A, mouse Clec12A, and human Clec12A has been previously described (24 (link)). For murine MARCO (NCBI: NP_034896.1, aa: 83-518) and human MARCO (NCBI: NP_006761.1, aa: 79-520), the cDNA of the extracellular domains (Origene, #MR222739 and #RC205625, respectively) were amplified by PCR and verified by restriction digest. Primers used in 5’-3’ direction: mMARCO forward = ATGTGCTGTGGCAATGGATC and reverse = GGAGCATTCCACACCCG; hMARCO forward = ATGTATTTCCTCAATGACACTCTG and reverse = GACGCTGCACTCCACG. The cDNAs were fused to the C-terminus of human IgG1-Fc in the expression vector pFUSE-hIgG1-Fc2 (InvivoGen, #pfuse-hg1fc2). After sequence verification, constructs were transfected into 293T cells (DSMZ, #ACC 635) using PolyJet Transfection Reagent as described above. Supernatants were harvested 48 and 72 h post transfection, pooled, sterile filtered, and stored at 4°C until usage as a source of recombinant proteins. Correct protein secretion was verified by Western blot analysis.