Steponeplus real time pcr system thermal cycling block

Primers were designed based on the sequence of 21 contigs showing in silico expression levels stable or variable among experimental modalities, and checked with NetPrimer (Premier Biosoft, Palo Alto, California). Amplification specificity and qPCR efficacy were checked for each contig as described [81 (link)]. Primer pairs retained for contig expression measurement had an efficiency value between 80 and 110 % (Additional file 3: Table S2). The expression level of the 21 contigs was measured in each of the 42 individual RNA samples used to create the 14 pooled samples subjected to RNA-Seq. Analyses were performed in duplicate (technical replicates) for each sample. Reverse transcription was performed using the Masterscript RT-PCR System kit (5 PRIME, Hamburg, Germany) starting from 5 μg total RNA. The StepOnePlus™ Real-Time PCR System Thermal Cycling Block (Applied Biosystems, Foster City, USA) was used to perform qPCRs in fast optical 0.1 mL, 96-well reaction plates (MicroAmp™, Applied Biosystems, Cheshire, UK). Reaction mixes, PCR programs, contig expression measurement and normalization with three previously validated reference genes using a five-point standard dilution curve were as described [81 (link)].

Total RNA was isolated using Trizol reagent (Beyond, R0016) according to the manufacturer’s protocol. Reverse transcription PCR was carried out using PrimeScript RT Reagent Kit (Takara Biotechnology, China). Quantitative PCR analysis was conducted using SYBR Green real–time PCR kit (TOYOBO, QPK–201) in a Veriti Thermal Cycler (Applied Biosystems, Life Technologies). A StepOnePlus Real–Time PCR System Thermal Cycling Block was used for data collection (Applied Biosystems, Life Technologies). The primers for the qPCR reactions were as follows: CFL1, 5′ TGCTGCCAGATAAGGACTGC 3′ and 5′ CTCTTAAGGGGCGCAGACTC 3′; 18S, 5′-GTAACCC GTT GAACCCCATT-3′ and 5′-CCATCCAATCGGTAGTAGCG-3′. The PCR reaction conditions were 10 s at 95°C followed by 40 cycles of 5 s at 95°C and 20 s at 60°C.

Three human-associated bacterial qPCR assays were performed on freshwater samples: sewage Lachnospiraceae, i.e., Lachno2 [38 (link)] and Lachno3 [39 ] and human Bacteroides combining the HF183F forward primer [40 (link)] with the reverse primer and probe from Kildare et al. [41 (link)]. Freshwater samples were quantified using a StepOne Plus™ Real-Time PCR System Thermal Cycling Block using Taqman hydrolysis probe chemistry with 2X Taqman® Gene Expression Master Mix (Applied Biosystems; Foster City, CA). For each run, triplicate standard curves were generated using a linearized plasmid containing the target sequence. The slope of the standard curves varied between − 3.312 and − 3.404 for Lachno2, − 3.394 and − 3.457 for Lachno3, and − 3.195 and − 3.369 for human Bacteroides. A correlation coefficient higher than 0.995 was observed for each assay standard curve. Amplification efficiencies ranged from 94.66 to 105.59%. Each method had limit of quantification of 15 gene copies per reaction.

Total RNA isolation was performed using Trizol reagent (Beyotime, R0016) according to the manufacturer’s protocol. Reverse transcriptional PCR was done using PrimeScript RT reagent kit (TaKaRa, DRR037A). qPCR analysis was undertaken in Verti Thermal Cycler (Applied Biosystem) using SYBR Green Real Time PCR kit (TOYOBO, QPK-201). Data collection was carried out using a StepOne Plus Real-Time PCR System Thermal Cycling Block (Applied Biosystems). Primers for qPCR reactions were as follows:

Bcl-2 (human): 5′-TTGAGGAAGTGAACATTTCGGTG-3′, 5′-AGGTTCTGCGGACTTCGGTC-3′;

PUMA (human): 5′-GACCTCAACGCACAGTA-3′, 5′-CTAATTGGGCTCCATCT-3′;

GAPDH (human): 5′-TGTTGCCATCAATGACCCCTT-3′, 5′-CTCCACGACGTACTCAGCG-3′.

The total RNA isolation was performed using the TRIzol reagent following the protocol established by the manufacturer. Reverse transcriptional PCR was performed using the PrimeScript RT reagent kit. The qPCR analysis was performed in a Verti Thermal Cycler (Applied BioSystems) using the SYBR Green Real-Time PCR kit. The data collection was conducted using a StepOnePlus Real-Time PCR System Thermal Cycling Block (Applied Biosystems). The primers used for the qPCR reactions were as follows: keratin 18, 5’-GGCATCCAGAACGAGAAGGA-3’ and 5’-AGTGCTCCCGGATTTTGCT -3’; GAPDH, 5’-TGTTGCCATCAATGACCCCTT-3’ and 5’-CTCCACGACGTACTCAGCG-3’. The PCR reaction conditions were 10 s at 95 °C followed by 40 cycles of 5 s at 95 °C and 20 s at 60 °C.

Reverse transcription of mRNA to cDNA was done using SuperScript III Reverse Transcriptase (Thermo Fisher) followed by amplification of cDNA using Power SYBR Green PCR Master Mix (Thermo Fisher). Reactions were performed using a StepOnePlus Real-Time PCR System Thermal Cycling block (Applied Biosystems). The relative gene expression levels were assessed according to the 2^−ΔCt method [79 (link)].
The primers used in this study are ctpC (ctpC-F: TCACCATTTTCACCGGGTAT; ctpC-R: GATGTTGAGCAACCACAGGA), ftsZ (ftsZ-F: CGGTATCGCTGATGGATGCTTT;ftsZ-R: CGGACATGATGCCCTTGACG), gapdh (gapdh-F: AATGAAGGGGTCATTGATGG; gapdh-R: AAGGTGAAGGTCGGAGTCAA), and sirt2 (sirt2-F: TCACACTGCGTCAGCGCCAG; sirt2-R: GGGCTGCACCTGCAAGGAG).