Mastercycler nexus

The 16S rRNA genes were amplified by PCR as described by Coombs and Franco using Mastercycler® nexus, Eppendorf and primers namely 27F (AGAGGTTGATCMTGGCTCAG) and 1492R (TACGGTACTTTTTACTACTTT)^{40 (link)}. Briefly, the amplifications were carried out in a total volume of 25 µL reaction mixture, including 12.5 µ of master mix (Sinaclon Cat.No.MM2062), 0.3 µL of each primer (10 pmol/μL), 1 µL of DNA template (50–100 ng), and 10.9 µL of D.W. Amplification was performed in a thermocycler (Mastercycler® nexus, Eppendorf). The thermocycle program was 94 °C for 4 min, followed by 30 cycles of 94 °C for 1 min, 50 °C for 2 min and 15 s and 72 °C for 2 min, and finally an extension step at 72 °C for 5 min. The PCR product was then confirmed by gel electrophoresis and UV-translummant device (Gel Doc device (Vilber, France). PCR products were sequenced by a commercial company, Macrogen, South Korea.

The Nested PCR amplification of the P. falciparum 18S rRNA gene was adapted from Singh et al. [36 (link)] with slight modification as previously reported [12 (link)]. Briefly, 200 nM dNTPs, 2 mM MgCl₂, 133 nM each of forward (rPLU6) and reverse (rPLU5) primers (Additional file 1: Table S1) and 1 U OneTaq DNA polymerase (NEB, UK) was used to amplify the 18S rRNA gene from 5 μL (~ 20 ng) of DNA in the primary PCR. The secondary PCR was performed using similar concentrations of reagents as in the primary reaction mix; however, rFal1 (forward) and rFal2 (reverse) primers were used to amplify 1 μL of the primary product. Genomic DNA from the 3D7 strain of P. falciparum (MRA 102G) was used as the positive control sample and distilled water (no template) served as the negative control sample. Positive and negative control samples were included in each PCR reaction set up. The amplified PCR products were separated alongside a 100 bp ladder (New England Biolabs, UK) on a 2% agarose gel stained with Ethidium bromide. The gels were subsequently viewed under ultra-violet light using the FUSION-FX7 advanced (Vilber Lourmat, Germany) chemiluminescence documentation system. All PCR assays were performed using the Eppendorf Mastercycler Nexus thermal cycler (Eppendorf, UK).

The Monarch RNA Cleanup Kit (New England BioLabs Inc.) was used as follows: a mix of 22.2 μl DNA/RNA extract, 2.5 μl DNase I reaction buffer and 0.3 μl DNase I enzyme was prepared on ice before incubation at 37°C for 20 min. Then, 0.5 μl of 0.25 M EDTA was added to each sample, followed by heat inactivation of DNase at 75°C for 15 min. Incubation and heat inactivation were both done in an Eppendorf Mastercycler nexus (Eppendorf AG).
The digested samples were thereafter screened for residuals of Drosophila DNA target molecules with the PCR protocol described for prey DNA detection below, but with a stricter detection threshold: in case any Drosophila DNA was still amplified in an RNA sample, the DNA digestion was repeated with more enzyme and a longer incubation. To do so, 22.0 μl fresh DNA/RNA extract, 2.5 μl DNase I reaction buffer, 0.5 μl DNase I enzyme were incubated at 37°C for 30 min. Inactivation and screening for residual DNA were the same as above. After this extended DNA digestion, no Drosophila DNA was detectable in any of the RNA samples.