Abi 7500 fast sequence detection system

The cells were dissolved in TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), and total RNA was extracted, according to the manufacturer's protocol. Total RNA (1 µg) was converted into 1 µg cDNA using an M-MLV reverse-transcription system (Invitrogen; Thermo Fisher Scientific, Inc.) in the presence of oligo (dT)₁₈ (Beijing TransGen Biotech Co., Ltd.). Reverse transcription-quantitative (RT-q)PCR was performed using an ABI-7500 Fast Sequence Detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.) with SYBR^® Green PCR mix (Beijing TransGen Biotech Co., Ltd.). The reaction system contained 10 µl 2X SYBR^® Green PCR Master mix (Beijing TransGen Biotech Co., Ltd.), 4 pmol of each primer (Sangon Biotech Co., Ltd.) and 0.2 µl RT reaction product. The samples were set in triplicate. The thermocycling parameters were as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 30 sec, and a detection step at 72°C for 30 sec. The specific gene primers were as follows: HIF-1α forward, 5′-AGG TGG ATA TGT CTG GGTTG-3′, HIF-1α reverse, 5′-AAG GAC ACA TTC TGT TTG TTG-3′; ADRP forward, 5′-GGC TAG ACA GGA TTG AGG AGAG-3′, and ADRP reverse, 5′-TCA CTG CCC CTT TGG TCTTG-3′. The relative abundance of the HIF-1α and ADRP transcript was quantified using the comparative Cq method (15 (link)), with β-actin as an internal control.

Serums of PTC patients were obtained from Fujian Medical University Union Hospital after surgical resection. Serums of PTC patients were obtained from Fujian Medical University Union Hospital. The study protocol was approved by the Institute Research Ethics Committee at Fujian Medical University Union Hospital. Total RNA was extracted from the serum and cell using Trizol (Invitrogen). cDCA was reverse‐transcribed using the TaqMan MiRNA Reverse Transcript Kit (Applied Biosystems). miRNAs were quantified using SYBR Premix Ex TaqTM (TaKaRa) by ABI 7500 Fast Sequence Detection System (Applied Biosystems Prism) and the relative expression using the 2‐ΔΔCT method. U6 forward, 5′‐AGAGCCTGTGGTGTCCG‐3′, reverse, 5′‐CATCTTCAAAGCACTTCCCT‐3′.