Qlaamp dna mini kit

The saliva samples were collected in BD Falcon 50 mL conical tubes (BD, Plymouth, UK). The DNA was extracted using the QlAamp DNA Mini Kit (Qiagen GmbH, Hilden, Germany), following the manufacturer’s instructions for purifying DNA from saliva, and was stored at −40 °C. The concentration and purity of the DNA were measured using a NanoDrop 2000 UV spectrophotometer with 280/260 and 280/230 absorbance ratios.

The saliva samples were collected with buccal swabs (Kit OCR-100). The DNA was extracted using the QlAamp DNA Mini Kit (Qiagen GmbH, Hilden, Germany), following the manufacturer’s instructions for purifying DNA from saliva, and stored at −40 °C. The DNA concentration and purity were measured using a NanoDrop 2000 UV spectrophotometer with the absorbance ratio at 280/260 and 280/230.

Genomic DNA of frozen tissue and cervical scrapings was extracted by using the QlAamp DNA Mini Kit (Qiagen GmbH, Germany). Sodium bisulfate treatment of extracted genomic DNA involved use of EpiTect Bisulfite kits (Qiagen GmbH, Germany). The extracted DNA and modified DNA underwent PCR with primers for the house-keeping gene GAPDH (forward: AGGTCGGAGTCAACGGATTTG, reverse: GTGATGGCATGGACTGTGGT) and β-actin (forward: TGGTGATGGAGGAGGTTTAGTAAGT, reverse: AACCAATAAAACCTACTCCTCCCTTAA).

The DNA of the isolates was extracted using the commercial kit method (QlAamp DNA mini kit-Qiagen). The 16S rRNA amplified by PCR (Applied Biosystems-9700) using universal primers (27F AGA GTT TGA TCM TGG CTC AG and 1492R GTA TTA CCG CGG CTG CTG G) and was sequenced by Genetic Analyzer 3130 (Applied Biosystems, USA) in Solgent Co. Ltd. (16S rRNA, Seoul, Korea). The aligned 16S rRNA of the isolate was subjected to BLAST with the nonredundant database of NCBI Genbank. Based on the maximum identity score was selected and aligned using ClustalW multiple alignment software [8 (link)].

Skeletal muscle samples were obtained from the affected knees using a QlAamp DNA Mini Kit (Qiagen, Hilden, Germany). Bisulfite-modified gDNA was prepared using the EZ DNA Methylation-Lightning™ kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s instructions. The bisulfite reaction was carried out using 200 ng gDNA (adjusted to a volume of 20 μl with sterile water) and 130 μl of CT Conversion Reagent. The sample tubes were placed in a thermal cycler (Thermo Scientific, Waltham, MA, USA) and subjected to the following conditions: 8 min at 98 °C, 60 min at 54 °C, and storage at 4 °C for up to 20 h. The DNA was then purified using reagents contained in the EZ DNA Methylation-Lightning™ kit (Zymo Research) according to the manufacturer’s instructions. The converted gDNA was eluted using 20 μl of M-Elution Buffer. DNA samples were finally stored at −20 °C until further use.