Imagequant las 4010 imager

Ten nanomolars partial duplex GQ containing the Cy5 dye at junction (Supplementary Table S1) were mixed with 10 nM of the G4R1 and incubated for a short time (3 min) in buffer containing 10 mM Tris–acetate pH 7.8, 50 mM KCl, 50 mM NaCl, 0.5 mM MgCl₂ and 10% glycerol. The reaction mixture was loaded and run on a 6% acrylamide gel at 65 V for 2 h with 0.5× TBE (Tris Borate EDTA) running buffer. Gel images were taken with ImageQuant LAS4010 imager from GE (General Electric). Analysis in ImageJ was used to quantify the percentage binding by taking the area of shifted band corresponding to G4R1 bound DNA and dividing it by the total area sum of DNA with G4R1 and DNA.

Protein samples were separated by SDS-PAGE and electrotransferred to a nitrocellulose membrane (Bio-Rad). After blocking for 1 h in TBST (10 mM Tris-HCl pH 7.4, 200 mM NaCl, and 0.05% Tween-20) containing 5% non-fat dry milk, blots were subjected to immunoblotting with primary antibodies overnight at 4°C, followed by incubating with a secondary antibody for 2 h at room temperature. Immunoblots were developed with Clarity™ Western ECL Substrate (Bio-Rad) and scanned with an ImageQuant LAS 4010 imager (GE Healthcare). For antibody reprobing, membranes were incubated three times for 10 min in a mild membrane stripping buffer (Abcam), extensively washed with TBST, and incubated with antibody. The intensity of bands was quantified by ImageJ software (National Institutes of Health).

Samples were lysed in M-PER mammalian protein extraction reagent (Thermo Fisher Scientific) supplemented with a proteinase inhibitor cocktail (Nacalai Tesque) and phosphatase inhibitor PhoSTOP (Roche). They were separated using TGX FastCast acrylamide gels (Bio-Rad Laboratories, Hercules, CA, USA) and transferred using a Trans-Blot Turbo Transfer System (Bio-Rad Laboratories). The membranes were blocked with 5% skim milk in Tris-buffered saline (150 mM NaCl and 20 mM Tris–HCl, pH 7.2) for 1 h at room temperature and then incubated with primary antibodies overnight at 4 °C. The membranes were then treated with horseradish peroxidase-conjugated donkey anti-rabbit secondary antibody (1:1000; Santa Cruz Biotechnology, Santa Cruz, CA, USA) for 1 h at room temperature. Each membrane was treated with WB Stripping Solution Strong (Nacalai Tesque) and stained with anti-actin beta antibody (MilliporeSigma), followed by incubation with horseradish peroxidase-conjugated donkey anti-mouse IgG secondary antibody (1:1000; Santa Cruz Biotechnology). The bound antibodies were visualized using SuperSignal West Pico (Thermo Fisher Scientific) on an Image Quant LAS 4010 imager (GE Healthcare Life Sciences, Pittsburgh, PA, USA). ACTB was used as an internal control.

Recombinant DNA polymerase α (CHIMERx, WI) activity was assayed according to the manufacturer’s recommended protocol. The substrates (dNTPs) were incubated for 30 min at 37°C with 60 mmol/l Tris-HCl (pH 7.0), 5 mmol/l MgCl₂, 0.3 mg/ml BSA, 1 mmol/l DTT, 0.1 μmol/l, 0.5 U DNA polymerase α, fluorescein isothiocyanate (FITC)-labeled primer (5′-FITCGTAAAACG ACGCC AGT-3′), and 0.1 μmol/l synthetic DNA template (5′-TCG GACTGGCCG TCG TTTTAC-3′, 5′-TCG CACTGGCCG TCG TTTTAC-3′, 5′-TCG AACTGGC CG TCG TTTTAC-3′, or 5′-TCG TACTGGCCGTCGTTTT AC-3′). The underlined sequences represent nucleotides that were modified partially to confirm the sites where F₃dTTP and FdUTP were inserted.
After the enzyme reactions were complete, samples were resolved by electrophoresis on an ERICA-S system (DRC, Tokyo, Japan) at 300 V for 3.5 h, and FITC-fluorescence was detected using an ImageQuant LAS 4010 imager (GE Healthcare).

Cells were cultured in the presence of PlsEtn for the indicated time periods, harvested in homogenizing buffer, and then sonicated (Honsho and Fujiki, 2017a (link)). Equal aliquots of total protein (3–10 μg) were separated using SDS-PAGE and transferred to a nitrocellulose membrane. The membrane was blocked by 1% BSA in TBST (10 mM Tris-HCl, pH 7.4, 200 mM NaCl, 0.05% Tween-20) for 1 h. The membrane was then incubated with primary antibodies overnight at 4°C, followed by incubation with secondary antibodies for 2 h at room temperature. Immunoblots were developed with Clarity™ Western ECL Substrate (Bio-Rad) and scanned with an ImageQuant LAS 4010 imager (GE Healthcare). The intensity of bands was quantified using the ImageJ software.

Imperial™ Protein Stain (ThermoFisher scientific, 24615) was used for Coomassie Blue Staining. Silver staining was completed using the Silver Staining Plus^TM kit (Bio-Rad) according to manufacturer instructions. For western blot analysis, Reovirus proteins were detected using polyclonal rabbit anti-reovirus antibodies (generously provided by Dr. Patrick Lee, Dalhousie University, 1:10000) followed by Cy2-conjugated anti-rabbit secondary antibodies (Jackson Immunoresearch 111-545-144, 1:5000). The sample blot was re-probed with mouse anti-β-actin antibodies (Santa Cruz sc74471, 1:1000) and Cy5-conjugated anti-mouse secondary antibodies (Jackson Immunoresearch 115-175-166, 1:3000). A separate blot was incubated with rabbit anti-STAT1 (Cell Signalling 9167, 1:1000) followed by Cy5-conjugated anti-rabbit secondary antibodies. Protein bands were visualized at respective wavelengths using an ImageQuant LAS 4010 imager (GE Healthcare).

EMSA with ds or ssDNA was carried out as described38 (link)39 (link) with minor modifications. A 290 bp segment containing wild-type ARS1 or a mutant (A⁻ B2⁻ B3⁻) were PCR amplified as described38 (link). Fragments carrying ARS306 or ARS609 were similarly amplified using primers HK278 (CCCACATGTAAGCTTAACTTCTTCGTGAGGAAGGAAAGTG) and HK279 (CCGACGTCAGATCTTAATTTATCTCATGAAGTAATGATAC) for ARS306, and HK280 (CCCACATGTCAATTTAGTATATTACTGTATATCTAGTTC) and HK281 (CCGACGTCGTTAAAAACAGAAAAGTAAAAATTCCGATCTTG) for ARS609. For ssDNA binding, DL11 (GTTACCATGGCATCGAGTTCTTCAACAAGACTACAATGG)39 (link) was used. These DNAs were labeled with Cy5-ddUTP using terminal transferase. ORC and Cdc6 were incubated with labeled DNA (1.6 nM as a fragment for Cy5-ARS; 3 nM for Cy5-DL11) and 300 ng of GC-rich competitor38 (link) for 10 min at room temperature in 5 μl of binding buffer (25 mM HEPES–KOH [pH 7.6], 100 mM potassium glutamate, 5 mM magnesium acetate, 5 mM calcium chloride, 5 mM DTT, 5% [v/v] glycerol, 0.1% [v/v] Triton X-100, 2 mg/ml BSA, and 1 mM ATP). DNA was separated by 4% 29:1 polyacrylamide gel electrophoresis, and fluorescent signals were detected in an ImageQuant LAS4010 imager (GE Healthcare).