Total cellular RNA was extracted using TRIzol (Invitrogen) and isolated utilizing chloroform and centrifugation with isopropyl alcohol. cDNA was synthesized with the M-MLV reverse transcription kit from Promega. Quantitative real-time polymerase chain reaction (PCR) was performed utilizing Roche lightcycler 480 PCR detection system on all samples in triplicate. 18S RNA was used to normalize mRNA expression levels. mRNA analysis was performed by culturing IECs to confluence and treating them for 24 hours with 1 μM morphine. qPCR analysis was performed using primers for Glial-Derived Neurotrophic Factor (GDNF). Primers were purchased from IDT. Primer sequences were as follows: GDNF - Forward 5′-CGAAGATTATCCTGACCAGTTTGA-3′, Reverse 5′ CAGTTCCTCCTTGGTTTCGTAG 3′; 18S 5′-GTAACCCGTTGAACCCCATT-3′.
Lightcycler 480 pcr detection system
Manufactured by Roche
Sourced in Switzerland, Germany
The LightCycler 480 PCR Detection System is a real-time PCR instrument designed for high-throughput quantitative and qualitative nucleic acid analysis. It employs a 96-well or 384-well plate format and provides precise temperature control and detection of fluorescence signals for accurate and efficient DNA amplification and quantification.
Automatically generated - may contain errors
4 protocols using lightcycler 480 pcr detection system
1
Morphine Modulates GDNF Expression in IECs
2
Quantifying Prodynorphin Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from spinal dorsal lumbar enlargements and BV-2 in TRIzol (Invitrogen, Carlsbad, CA, USA) on ice and then reverse transcribed into cDNA and subjected to qPCR. QPCR was performed with Roche LightCycler 480 PCR Detection System (Roche, Switzerland). The fold change was calculated using the 2-ΔΔCt method after normalization to GAPDH. The primer sequences are as follows: GAPDH (5′-ATC CCA TCA CCA TCT TCC AGG AG-3′ and 5′ CCT GCT TCA CCA CCT TCT TGA TG 3′) and Prodynorphin (5′-CGG AAC TCC TCT TGG GGT AT-3′ and 5′-CGG AAC TCC TCT TGG GGT AT-3′).
3
Validation of Differentially Expressed Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Among DEGs, eight genes were randomly selected for qPCR validation. The qRT-PCR was performed with a Roche LightCycler 480 PCR Detection System (Roche, Germany). The analysis of each sample was repeated three times, and the 2−ΔΔCT method was used to perform data analysis. The N. haitanensis ubiquitin-conjugating enzyme gene (PhUBC) was used as an internal reference gene [51 (link)]. In this study, all the primers are shown in Table S14 .
4
Quantitative RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using RNAeasy Mini Kits (Qiagen, Cat. No. 74104) according to the manufacturer’s instructions. On-column DNase digestion was performed using the RNase-Free DNase Set (Qiagen, Cat. No. 79254). The integrity of total RNA was analysed using a Nanodrop 1000 spectrophotometer (Thermo, USA).
qRT-PCR was performed using the SYBR Green method, as previously described36 (link). Briefly, 1 μg of total RNA served as the template for the first-strand cDNA synthesis in a reaction using an oligo(dT) primer and Moloney murine leukaemia virus (MMLV) reverse transcriptase under the conditions described by the manufacturer. A LightCycler 480 PCR detection system (Roche Diagnostics Ltd.) was used for the quantitative assessment of RABV N and viperin mRNA under standard cycling conditions. β-actin gene expression was assessed as a control for all reactions. The primer sequences are listed inTable S1 .
qRT-PCR was performed using the SYBR Green method, as previously described36 (link). Briefly, 1 μg of total RNA served as the template for the first-strand cDNA synthesis in a reaction using an oligo(dT) primer and Moloney murine leukaemia virus (MMLV) reverse transcriptase under the conditions described by the manufacturer. A LightCycler 480 PCR detection system (Roche Diagnostics Ltd.) was used for the quantitative assessment of RABV N and viperin mRNA under standard cycling conditions. β-actin gene expression was assessed as a control for all reactions. The primer sequences are listed in
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!