Mouse gingival fibroblasts were serum-starved for 24 h then stimulated with 1 μg/mL E. coli LPS for 24 h. Total mRNA was extracted using RNase mini kit (Giagen, Hilden, Germany). The total RNA were reversely transcript to cDNA by (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The mRNA expression of IL-1β was measured by RT-PCR, which was performed on Bio-radS1000™ Thermal Cycler (Bio-Rad Laboratories) using GoTaq Green Master Mix (VWR International, Radnor, PA, USA). Primer sequences were forward ACCTAGCTGTCAACGTGTGG; reverse TCAAAGCAATGTGCTGGTGC.
Gotaq green master mix
Manufactured by Avantor
Sourced in United States
GoTaq Green Master Mix is a ready-to-use solution for polymerase chain reaction (PCR) amplification. It contains Taq DNA polymerase, buffer, MgCl2, and dNTPs, as well as a tracking dye for direct gel loading.
Automatically generated - may contain errors
4 protocols using gotaq green master mix
1
LPS-induced IL-1β Expression in Fibroblasts
2
Efficient Genotyping Using Tail Biopsies
3
LPS-induced mRNA expression in gingival fibroblasts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gingival fibroblasts were serum starved for 24 h then treated with 1 μg/ml LPS for 24 h.
Total mRNA was isolated using RNase mini kit (Qiagen, Hilden, Germany). Approximately, 1 μg of total RNA was used to synthesize cDNA with (Bio-Rad Laboratories, Inc., Hercules, CA, USA). mRNA expression was determined by RT-PCR, which was performed on Bio-Rad's S1000 Thermal Cycler (Bio-Rad Laboratories) using GoTaq Green Master Mix (VWR International, Radnor, PA, USA). Primer sequences used are shown inSupplementary Table 1 .
Total mRNA was isolated using RNase mini kit (Qiagen, Hilden, Germany). Approximately, 1 μg of total RNA was used to synthesize cDNA with (Bio-Rad Laboratories, Inc., Hercules, CA, USA). mRNA expression was determined by RT-PCR, which was performed on Bio-Rad's S1000 Thermal Cycler (Bio-Rad Laboratories) using GoTaq Green Master Mix (VWR International, Radnor, PA, USA). Primer sequences used are shown in
4
Modulating Gingival Fibroblast Inflammation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse gingival fibroblasts were serum-starved for 24 h, then treated with 1 μg/ml LPS with or without 500 ng/ml anakinra for 24 h. Total mRNA was isolated from gingival fibroblasts or gingival tissue using RNeasy mini kit (Qiagen, Valencia, CA). cDNA was synthesized from 1 μg of total RNA with the iScript cDNA kit (Bio-Rad Laboratories). Receptors mRNA expression was determined by quantitative RT-PCR using primers in Supplementary Table S1 and GoTaq Green Master Mix (VWR International, Radnor, PA). Expression of mRNA was normalized to β-actin levels and expressed as fold change using the comparative threshold cycle (Ct) method (2−ΔΔCt). Primers used were described in Supplementary Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!