Total RNA was extracted from pHUVECs treated with succinate or inhibitors for 12h. For first-strand cDNA synthesis, 500 ng of total RNA was retrotranscribed using Prime Script RT reagent Kit (Thermo Fisher Scientific, Waltham, MA, USA). The resultant cDNA was subsequently amplified with the Maxima SYBR-Green/Rox qPCR Master Mix 2X kit (Thermo Fisher Scientific, Waltham, MA, USA) using the StepOnePlus Real-Time PCR System (Thermo Fisher Scientific). Changes in the expression of VEGF gene was determined relative to the mean critical threshold (CT) values of GAPDH gene. Human VEGF gene primers are 5′-AGGGCAGAATCATCACGAAGT- 3′ and 5′-AGGGTCTCGATTGGATGGCA-3′. Human GAPDH gene primers are 5′- TTGCCATCAATGACCCCTTCA- 3′ and 5′- CGCCCCACTTGATTTTGGA- 3′.
Maxima sybr green rox qpcr master mix 2x kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Maxima SYBR Green/ROX qPCR Master Mix (2X) kit is a premixed solution that contains all the necessary components for real-time quantitative PCR (qPCR) reactions, including SYBR Green I and ROX passive reference dye. The kit is designed for sensitive and reproducible detection and quantification of DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Steponeplus real time pcr system, by Thermo Fisher Scientific (3 mentions)
Primescript rt reagent kit, by Thermo Fisher Scientific (2 mentions)
First strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Rotor gene q real time pcr cycler, by Qiagen (1 mentions)
Maxima first strand cdna synthesis kit for rt qpcr, by Thermo Fisher Scientific (1 mentions)
Rotor gene q, by Qiagen (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Applied biosystems 7500, by Thermo Fisher Scientific (1 mentions)
Pgem t easy vector system, by Promega (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Superscript first strand synthesis system, by Thermo Fisher Scientific (1 mentions)
Goldview, by Solarbio (1 mentions)
Iq5 optical system software, by Bio-Rad (1 mentions)
Tripure, by Roche (1 mentions)
11 protocols using maxima sybr green rox qpcr master mix 2x kit
1
Quantifying VEGF Expression in pHUVECs
2
Quantification of RSV Viral Copies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
10 ng of RNA were used for the Retrotranscription using the RevertAid H kit Minus First Strand cDNA Synthesis Kit (Thermo Scientific, Waltham, MA, USA). First Strand cDNA Synthesis Kit (Thermo Scientific, Waltham, MA, USA). From this cDNA, PCR was performed for absolute quantification of RSV viral copies using the following primers: MCVF (5′-GGCAAATATGGAAACATACGTGAA-3′) and MCVR (5′-TCTTTTTCTAGGACATTGTAYTGAACA-3′), at a final concentration of 0.25 μm, which are directed to the intergenic region between the RSV P and M genes and generate an 87 bp product. As a control for the standard curve, a 2752 bp pUCIDT that has a 500 bp synthetic construct including the quantification PCR target site was used. qPCR was performed with the Maxima SYBR Green/ROX qPCR Master Mix (2x) kit (Thermo Scientific, Waltham, MA, USA) as indicated in the insert, the cDNAs obtained were analyzed in duplicate, as well as the 6 points of the standard curve. The data of the experiment were considered adequate if the standard curve correlation coefficient was greater than 0.98. The quantification was carried out by means of the linear regression method using the parameters of the line from the standard curve. All experiments were performed in duplicate, and we analyzed two biological replicas.
3
Quantitative Analysis of CDK6 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer's protocol. For first‐strand cDNA synthesis, 500 ng of total RNA was retrotranscribed using Prime Script RT reagent Kit (Thermo Fisher Scientific). The resultant cDNA was subsequently amplified with the Maxima SYBR‐Green/Rox qPCR Master Mix 2X kit (Thermo Fisher Scientific) using the StepOnePlus Real‐Time PCR System (Thermo Fisher Scientific). All reactions were run in triplicate. Changes in the expression of CDK6 gene was determined relative to the mean critical threshold (CT) values of GAPDH gene. The primer pairs used were as follows: CDK6, 5′‐CGGGATCCACCATGGAGAAGGACGGCCTG‐3′ (forward) and 5′‐CGGATCCATTGCTCAGGCTGTATTCAGCTCCGA‐3′ (reverse); and GAPDH, 5′‐CTCTGCTCCTCCTGTTCGAC‐3′ (forward) and 5′‐CGACCAAATCCGTTGACTCC‐3′ (reverse).
4
Oxidative Stress Enzyme Indicators in Gonadal Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from the ovaries and testes was extracted by the triazole method. Reverse Aid First-strand complementary DNA (cDNA) synthesis kit (Thermo Scientific) was used for the synthesis of first-strand cDNA from 1 μg of total RNA. The oxidative stress enzyme indicators, i.e., CAT, SOD2, GPX1, and GR expressions in ovaries and testes were evaluated by RT-qPCR. The total reaction mixture volume was 25 microliters with thermal cycling in three steps. The reaction mixture was first gone through denaturation for 10 min at 95°C then again denatured for 15sec at 95°C followed by annealing for 30 sec at 60°C and final extension for 30 sec at 72°C. Denaturation, annealing, and extension comprised 40 cycles. Thermo Scientific Maxima SYBR Green/ROX qPCR master mix (2X) kit was used and the parallel sense and antisense were shown in Table 1 . Primers were acquired from The Worldwide Scientific. The difference in gene expression between the control and treated groups was reported by the delta-delta cycle threshold (Ct) method [12 (link)]. GAPDH was used as a reference housekeeping gene. Primer sequence (5′⟶3′) of GAPDH, SOD2, CAT, GPX1, and GR [13 ].
5
Hepatic gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from liver tissues collected at indicated time after APAP injection using the Ultrapure RNA kit (Thermo Fisher Scientific, Invitrogen, MA, USA) and transcribed into cDNA using the reverse transcription kit (Thermo Fisher Scientific, Waltham, MA, USA). Subsequently, the resultant cDNA was amplified with the Maxima SYBR-Green/Rox q-PCR Master Mix 2X kit (Thermo Fisher Scientific, Waltham, MA, USA) using the Step One Plus Real-Time PCR System (Thermo Fisher Scientific). Primers used in the PCR-reactions were synthesized in Invitrogen (Shanghai, China) as followed: GAPDH (CAT CAC TGC CAC CCA GAA GAC TG, ATG CCA GTG AGC TTC CCG TTC AG); 18S ribosomal RNA (rRNA) (AGG GGA GAG CGG GTA AGA GA, GGA CAG GAC TAG GCG GAA CA); CD36 (GGA CAT TGA GAT TCT TTT CCT CTG, GCA AAG GCA TTG GCT GGA AGA AC); IL-1β (TGG ACC TTC CAG GAT GAG GAC A, GTT CAT CTC GGA GCC TGT AGT G); TNF-α (GGT GCC TAT GTC TCA GCC TCT T, GCC ATA GAA CTG ATG AGA GGG AG); IL-6 (TAC CAC TTC ACA AGT CGG AGG C, CTG CAA GTG CAT CAT CGT TGT TC); KC (ACT GCA CCC AAA CCG AAG TC, TGG GGA CAC CTT TTA GCA TCT T); MCP1 (TGT ACC ATG ACA CTC TGC AAC, CAA CGA TGA ATT GGC GTG GAA).
6
Gene Expression Analysis by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gene expression of Pomc, Npy, Lepr, and Igf2 was assessed by real-time polymerase chain reaction (qPCR). The complementary DNA (cDNA) was synthetized from 0.5 μg of RNA from each sample, using a Maxima First Strand cDNA Synthesis Kit for RT-qPCR (ThermoFisher Scientific, Waltham, USA). The qPCR for each gene was performed using a Maxima SYBR Green/ROX qPCR Master Mix (2X) kit (ThermoFisher Scientific, Waltham, USA) and Rotor-Gene Q Real-Time PCR cycler (Qiagen Inc., Hilden, Germany). The primers used are shown in Table 2 . Rotor-Gene Q 2.0 software was used to calculate the cycle threshold (Ct) and the relative levels of expression of the target genes were normalized to housekeeping gene Gapdh with the 2−ΔΔCt method.
7
Quantitative Analysis of Osteogenic Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was firstly reverse-transcribed by High-Capacity cDNA Reverse Transcription Kit (Thermo, USA). Complementary DNA (cDNA) was used to examine the expression of Runx-2, and ALP by real-time PCR (q-PCR) using Maxima SYBR Green/ROX qPCR Master Mix (2X) Kit (Thermo, USA) and reacted in Qiagen Rotor-Gene Q. Expression of genes in interest were then calculated by the formula. The internal control utilized in the study was β-actin. Table 1 displays the primers employed in the PCR experiments [28 ,29 ].Table 1
The primers employed for quantitative polymerase chain reaction.
| Function | Gene | Primer | Sequence |
|---|---|---|---|
| Internal control | β-actin | 5′-primer | GTGCGTGACATTAAGGAGAAGCTGTGC |
| 3′-primer | GTACTTGCGCTCAGGAGGAGCAATGAT | ||
| Osteogenic markers | Runx-2 | 3′-primer | CAGATGGGACTGTGGTTACTGTCATGG |
| 5′-primer | CCTAAATCACTGAGGCGGTCAGAGAAC | ||
| ALP | 3′-primer | ACGTGGCTAAGAATGTCATC | |
| 5′-primer | CTGGTAGGCGATGTCCTTA |
8
Quantification of Bacterial and Archaeal 16S rRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The estimation of bacterial and archaeal 16 S rRNA abundance was done through real‐time PCR. Table 1 represents primer sets selected for archaeal and bacterial amplification. Standard curves were constructed using the pGEM‐T Easy Vector System (Promega, United States) cloned with bacterial or archaeal 16 S rRNA genes. Bacterial DNA was extracted from Escherichia coli, while the archaeal one was extracted from Methanosarcina thermophila. 100‐fold serial dilutions were used to cover a range of 1E10 to 1E01 gene copies/μl (Tao et al., 2020 ). Real‐time PCR was performed using Maxima SYBR Green/ROX qPCR Master Mix (2X) kit (Thermo Fisher Scientific, United States) and applied biosystems 7500 (Thermo Fisher Scientific, United States). The total reaction volume was 10 μl. 0.5 μl of template DNA and 0.5 μl of each primer (10 μM) were added to each reaction. The reaction was set according to the manufacturer's protocol. The annealing temperature for bacterial reactions was 53°C (Stubner, 2004 (link)) while for archaeal reactions was 60°C (Lee et al., 2008 (link)). All reactions were set in triplicates, and negative control was set in all 96‐well plates.
9
Quantifying HSP60 Gene Expression via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of HSP60 gene was analyzed through a qPCR (Bio-Rad-iQ50) approach. The primers were designed as forward TAGTGGTCCAAAGGAAGCTATTC and reverse CAAACGCTCTTGCAGTTTCTC. Βeta-actin gene was used for normalization. Total RNA was isolated and purified from 30 million cells for each strain by using an RNA isolation kit (Ambion Technology). Nano drop was used for quantification. DNAse 1 treatment was performed before the synthesis of cDNA. cDNA was made with the help of first strand cDNA sntehsis kit (Thermo scientific). 100 ng DNA a 25-μL reaction was set using Maxima SYBR green /ROX qPCR master mix(2X) kit (Thermo Scientific) with 50 nmol forward and reverse primers. PCR was run as 95˚C for 10 min and 40 cycles of 60˚C for 15 sec, 60˚C for 30 sec and 72˚C for 30 sec. CT values were normalized and relative expression of that signal gene measured through 2-ΔΔCT method. Triplicate measurements were done for each of the three biological replicas.
10
Quantifying Alzheimer's-Related Signaling Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In brief, Akt, Erk1/2, PI3K, MAPK, Wnt3a, β-Catenin, and GSK-3β expression were assessed in different groups. To this end, total RNA contents were isolated from brain samples using the RNeasy mini-kit (Qiagen). After that, cDNA was synthesized using the Revert AidTM First Strand cDNA Synthesis kit (Fermentas). The real-time PCR reaction was done using Maxima™SYBR Green/ROX qPCR Master Mix (2X) kit (Fermentas). The expression of each gene was quantified using the 2−ΔΔCT formula. This assay was done in triplicate. The primers were designed using Oligo7 software (Table 1 ).
Primer sequence
| Gene | Primer | TM (˚C) |
|---|---|---|
| β-actin | F: GGCTGTATTCCCCTCCATCG R: CCAGTTGGTAACAATGCCATGT | 60 |
| Gsk3b | F: GAGCCACTGATTACACGTCCAG R: CCAACTGATCCACACCACTGTC | 63 |
| Wnt3a | F: CACCACCGTCAGCAACAGCC R: AGGAGCGTGTCACTGCGAAAG | 58 |
| Akt1 | F: GCTTCTATGGTGCGGAGATTGT R: CGTCCTTGATCCCCTCCTTG | 63 |
| MAPK1 or ERK2 | F: ATTGATATTTGGTCTGTGGGCT R: CCTGTTCCATGGCACCTTATTT | 63 |
| MAPK3 or ERK1 | F: TCTGGTCTGTGGGCTGCATTC R: GGTAGTTTCGGGCCTTCATGT | 63 |
| PI3K | F: AGTAACAGACTAGCCAGAGACAA R: TTGACAGACAGAAGCAATTTGGG | 60 |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!