B 005000 100

Manufactured by Horizon Discovery

The B-005000-100 is a laboratory equipment product offered by Horizon Discovery. It is designed for a core function, but a detailed and unbiased description cannot be provided while maintaining conciseness.

Automatically generated - may contain errors

Lab products found in correlation

B 002000 ub 100, by Horizon Discovery (2 mentions) Accell sirna oligos, by Horizon Discovery (1 mentions) Tumor necrosis factor (tnf), by R&D Systems (1 mentions) Myd88, by Horizon Discovery (1 mentions) Keratinocyte serum free medium, by Thermo Fisher Scientific (1 mentions) Il 36γ, by R&D Systems (1 mentions) Control sirna, by Horizon Discovery (1 mentions) Recombinant human il 1β, by R&D Systems (1 mentions) Smartpool sirna, by Horizon Discovery (1 mentions)

6 protocols using b 005000 100

Silencing Tet1 in Hypothalamic Neurons

Check if the same lab product or an alternative is used in the 5 most similar protocols

siRNA experiments were conducted using Accell SMARTpool siRNA, which targets 4 portions of the Tet1 mRNA transcript (CUAUUUGUCUAUUAUGUGUG, UCGUUGGGUCUAAAGGCUU, UCGCUAAACUAACUAUAAAUGUAU, UUAUAGUUUUAAAUACUUA). A non-targeting siRNA pool was used as a negative control (UGGUUUACAUGUCGACUAA, UGGUUUACAUGUUUUCUGA,UGGUUUACAUGUUUUCCUA, UGGUUUACAUGUUGUGUGA). All siRNAs were resuspended in 5x siRNA buffer diluted in RNase free water. GT1-7 hypothalamic neurons were seeded in 24-well plates in DMEM and FBS with 1% penicillin/streptomycin. Growth medium was removed and replaced with Accell delivery media (Dharmacon, B-005000-100) with 1 μM Tet1 siRNA (Dharmacon, E-06861-00-0020) or non-targeting control (Dharmacon, D-001910-20-20). After 3 days, cells were collected for RNA as described previously.

Linscott M.L, & Chung W.C. (2019). TET1 regulates fibroblast growth factor 8 transcription in gonadotropin releasing hormone neurons. PLoS ONE, 14(7), e0220530.

+ Open protocol

+ Expand

Th17 Differentiation with IL-24 Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

Naive T cells purified from wild-type mice (by MACS) were differentiated into Th17 cells in reduced-serum medium (siRNA delivery medium; B005000-100; Dharmacon). On day 1, cells were treated with Accell siRNA oligos targeting IL-24 (1 µm, E-050687-00-0005; Dharmacon) or control oligos (1 µm, D-001910-01-05; Dharmacon). On day 3, cells were analyzed for intracellular IL-10 and IL-17A.

Sie C., Kant R., Peter C., Muschaweckh A., Pfaller M., Nirschl L., Moreno H.D., Chadimová T., Lepennetier G., Kuhlmann T., Öllinger R., Engleitner T., Rad R, & Korn T. (2022). IL-24 intrinsically regulates Th17 cell pathogenicity in mice. The Journal of Experimental Medicine, 219(8), e20212443.

+ Open protocol

+ Expand

Immortalized KC Cell Line Cytokine Treatment

Check if the same lab product or an alternative is used in the 5 most similar protocols

N/TERTs, an immortalized KC cell line (Dickson et al., 2000 (link)), was grown in Keratinocyte-serum-free medium (17005-042, Thermo Fisher Scientific, Waltham, MA) supplemented with 30 μg/ml bovine pituitary extract, 0.2 ng/ml EGF, and 0.3 mM calcium chloride. Cells at proper confluency were subsequently treated with recombinant human IL-1β (10 ng/ml, R&D Systems, Minneapolis, MN), IL-36γ (10 ng/ml, R&D Systems), and TNF (10 ng/ml, R&D Systems) for the indicated time before RNA or protein extraction.
siRNA targeting IRAKs, including IRAK2 (Accell Human IRAK2 siRNA, E-004761-00-0010), IRAK1 (E-004760-00-0010), and IRAK4 (E-003302-00-0010); ZNF750 (E-014417-00-0010); IL1R (E-005188-00-0005); MYD88 (E-004769-00-0005); and control siRNA (D-001910-01-20) were purchased from Dharmacon company (Lafayette, CO) and introduced into cells by Delivery medium (B-005000-100, Dharmacon) according to the manufacturer’s instructions.

Shao S., Tsoi L.C., Swindell W.R., Chen J., Uppala R., Billi A.C., Xing X., Zeng C., Sarkar M.K., Wasikowski R., Jiang Y., Kirma J., Sun J., Plazyo O., Wang G., Harms P.W., Voorhees J.J., Ward N.L., Ma F., Pellegrini M., Merleev A., White B.E., Modlin R.L., Andersen B., Maverakis E., Weidinger S., Kahlenberg J.M, & Gudjonsson J.E. (2021). IRAK2 Has a Critical Role in Promoting Feed-Forward Amplification of Epidermal Inflammatory Responses. The Journal of investigative dermatology, 141(10), 2436-2448.

+ Open protocol

+ Expand

Human iPSC-Derived Retinal and Brain Tissue Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human cortical and retinal tissues were induced from human iPS cells as described previously 35 . iPSderived embryoid bodies with optic vesicles, which are primordia of the brain and retina, were adhered to 24-well plates 22 days after the start of neuronal differentiation. After 48 h, culture medium was replaced with Accell siRNA delivery media (Dharmacon B-005000-100) containing 100 µM Accell Human siRNA (Dharmacon C7orf26, E-016351-00-0005; Non-targeting, D-001910-01) and then cultured for 3 days.
Retinal and brain tissues were dissected from colonies for subsequent qRT-PCR analysis.

Azuma N., Yokoi T., Tanaka T., Matsuzaka E., Saida Y., Nishina S., Terao M., Takada S., Fukami M., Okamura K., Maehara K., Yamasaki T., Hirayama J., Nishina H., Handa H, & Yamaguchi Y. (2023). Integrator complex subunit 15 controls mRNA splicing and is critical for eye development. Human molecular genetics, 32(12).

+ Open protocol

+ Expand

siRNA-Mediated Knockdown of β-Arrestin 1 in Mouse Islets

Check if the same lab product or an alternative is used in the 5 most similar protocols

For β-arrestin 1 (Barr1) siRNA studies, CAMPER primary mouse islets were dispersed by trituration in 0.05% trypsin/EDTA for 3 min at 37°C and seeded at the center of poly-d-lysine–coated glass-bottom dishes. Dispersed islets were allowed to recover overnight before treatment with Accell mouse Arrb1 (109689) siRNA-SMARTpool (E-040976-00-0005, Horizon Discovery) or nontargeting control siRNA (D-001910-01-05, Horizon Discovery) according to the manufacturer’s instructions using the recommended siRNA buffer (B-002000-UB-100, Horizon Discovery) and serum-free delivery medium (B-005000-100, Horizon Discovery). Studies took place 72 hours after siRNA treatment addition.

Bitsi S., El Eid L., Manchanda Y., Oqua A.I., Mohamed N., Hansen B., Suba K., Rutter G.A., Salem V., Jones B, & Tomas A. (2023). Divergent acute versus prolonged pharmacological GLP-1R responses in adult β cell–specific β-arrestin 2 knockout mice. Science Advances, 9(18), eadf7737.

+ Open protocol

+ Expand

CD22 Knockdown Using Accell siRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Accell siRNAs against human CD22 (set of 4) were synthesized by Dharmacon (Horizon Discovery, EQ-019501-00-0002). 5× siRNA buffer (Horizon Discovery, B-002000-UB-100) combined with sterile RNase-free water was used to prepare 1× siRNA buffer. Lyophilized siRNA was reconstituted to 100 μM siRNA solution in 1× siRNA buffer. According to the manufacturer’s experimental conditions, siRNA medium was prepared by adding 1 μM siRNA solution to 1× Accell delivery medium (Horizon Discovery, B-005000-100). Finally, cells were incubated either with siRNA medium or Accell delivery medium alone at 37°C with 5% CO₂ for 96 h.

Ruiz-Ciancio D., Lin L.H., Veeramani S., Barros M.N., Sanchez D., Di Bartolo A.L., Masone D., Giangrande P.H., Mestre M.B, & Thiel W.H. (2023). Selection of a novel cell-internalizing RNA aptamer specific for CD22 antigen in B cell acute lymphoblastic leukemia. Molecular Therapy. Nucleic Acids, 33, 698-712.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!