Total RNA was extracted using a phenol-chloroform protocol as described by Dubey et al. [56 (link)], followed by NaOAc/ethanol purification and proceeded to the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Traces of DNA were removed by DNase I treatment (Fermentas). RNA concentration was determined spectrophotometrically using Nano-Drop (Thermo Scientific), and RNA quality was assessed after electrophoresis on an Agilent Bioanalyzer using the RNA 6000 nano kit (Agilent Technologies, Santa Clara, CA) according to the manufacturer’s instructions. DNase I treated RNA was further diluted to 1-2 μg/μl for microarray analysis.
Dnasei treatment
Manufactured by Thermo Fisher Scientific
Sourced in United States
DNaseI treatment is a laboratory reagent used to remove DNA from samples. It functions by enzymatically digesting DNA, thereby eliminating its presence in the sample. This product is designed for use in various molecular biology applications where the removal of DNA is required.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (7 mentions)
Nanodrop, by Thermo Fisher Scientific (4 mentions)
Agilent bioanalyzer, by Agilent Technologies (2 mentions)
Rna 6000 nano kit, by Agilent Technologies (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Control sirna, by Thermo Fisher Scientific (2 mentions)
High capacity reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Neon transfection system, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Rneasy plant mini kit, by Qiagen (1 mentions)
Rna xpress reagent, by HiMedia (1 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (1 mentions)
Hiseq 2000 platform, by Illumina (1 mentions)
Sybr green master mix, by Thermo Fisher Scientific (1 mentions)
S1pr1, by Thermo Fisher Scientific (1 mentions)
Icam 1, by Thermo Fisher Scientific (1 mentions)
Truseq mrna library preparation kit, by Illumina (1 mentions)
Hiseq 2500 platform, by Illumina (1 mentions)
Poly a tailing kit, by Thermo Fisher Scientific (1 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
14 protocols using dnasei treatment
1
Total RNA Extraction and Purification
2
Extraction and Purification of Total RNA from A. fumigatus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from A. fumigatus culture WT, compound treated, and ΔpksP using RNA-Xpress reagent (HiMedia, India) as per given
manufacturer’s instruction. DNaseI treatment (Fermentas, USA)
was given to the isolated RNA using the user guidelines provided by
Fermentas to remove genomic DNA contamination. The purity of isolated
RNA was measured by A260/280 and A260/230 ratios using nanodrop (Thermo Scientific
Multiskan GO). Samples with <1.8 ratio for either of the absorbance
ratio were not used for further analysis. Two micrograms of total
RNA of each sample was used to synthesize first-strand cDNA by oligo
(dT)18 primer using the high cDNA synthesis Kit (HiMedia,
India).
manufacturer’s instruction. DNaseI treatment (Fermentas, USA)
was given to the isolated RNA using the user guidelines provided by
Fermentas to remove genomic DNA contamination. The purity of isolated
RNA was measured by A260/280 and A260/230 ratios using nanodrop (Thermo Scientific
Multiskan GO). Samples with <1.8 ratio for either of the absorbance
ratio were not used for further analysis. Two micrograms of total
RNA of each sample was used to synthesize first-strand cDNA by oligo
(dT)18 primer using the high cDNA synthesis Kit (HiMedia,
India).
3
RNA Extraction and Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from leaf samples using TRIzol® reagent (Invitrogen, United States) following the manufacturer’s instructions and DNase I treatment was used to remove the genomic DNA (Fermentas, United States). An Agilent 2100 Bioanalyzer was used to measure the RNA integrity number (RIN), while the RNA quality and purity were assessed using a nanodrop at the ratios of A260/A280 and A260/A230. The RNA samples that met all the quality standards (RNA concentration ≥ 100 ng/μl, A260/A280 ≥ 1.8, A260/A230 ≥ 1.8, RIN ≥ 8, and 28S/18S > 1) were then subjected to cDNA library construction at the Biomarker Technologies Corporation (Beijing, China). Qualified libraries were submitted for transcriptome sequencing at the Illumina Hiseq 2000 platform and paired-end (PE) read sequences were obtained through image analysis and base calling of the sequencing data. The adapter sequences and low-quality reads were eliminated from raw data and the clean PE reads (PE 125 bp) were deposited in the Sequence Read Archive (SRA) database1 under the accession numbers of SRR12357394 to SRR12357399 .
4
Silencing Cell Surface Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
JeKo-1 or REC-1 cells were transfected with 500 nM specific ICAM1, BTK, S1PR1 (cat# 4390824, s4447, Invitrogen, CA, USA), or control siRNA (Life technologies, NY, USA) using the Neon transfection system (Thermo Fisher Scientific, TMO, NY, USA) (1650 V, 13 ms, 2 Pulses). Total RNA from JeKo-1 or REC-1 cells was isolated using TRIzol (Thermo Fisher scientific) followed by DNaseI treatment (Fermentas, MA, USA). A 1 μg sample of RNA was reverse-transcribed into cDNA using High-Capacity Reverse Transcription kit (Thermo Fisher Scientific). Real-time quantitative PCR was performed with 2 μL of cDNA using 2× SYBR Green Master Mix (Applied Biosystems, Carlsbad, CA, USA).
5
Transcriptomic Profiling of Plant Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from both vegetative and crossing tissue, prepared as outlined above. Traces of DNA were removed by DNase I treatment (Fermentas). The RNA concentration and quality was determined spectrophotometrically using Nano-Drop (Thermo Scientific), and RNA quality was assessed after electrophoresis on an Agilent Bioanalyzer using the RNA 6000 Nano Kit (Agilent Technologies, Santa Clara, CA) according to the manufacturer’s instructions. Sequencing libraries for mRNA were constructed by following the standard protocols of Illumina TruSeq mRNA library preparation kits, respectively (Cat# RS-122-2101/2102, Illumina Inc). Sequencing was performed on Illumina HiSeq 2500 platform at SciLifeLab Uppsala, to generate 125 bp paired-end reads. All steps were performed separately for the biological replicates.
6
Quantitative Analysis of miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from harvested tissues using TRI Reagent (Sigma) followed by DNaseI treatment (Fermentas). Small RNA samples enriched using 4M LiCl were polyadenylated using Poly(A) Tailing kit (Ambion) and 2 μg of each sample was reversed transcribed with miR_oligodT_RTQ primer for first strand cDNA synthesis using SuperScript II Reverse Transcriptase (Invitrogen). To analyze the expression of the mature miRNAs, qRT-PCR was done using TaqMan Fast Universal PCR Master Mix (ABI) with RTQ universal reverse primer, miRNA specific forward primer and fluorogenic probe68 (link) in StepOnePlus Real-Time PCR System (ABI) according to the manufacturer’s protocol. The expression level of miRNA was normalized using 5S rRNA’s expression as an endogenous control. ∆∆Ct method was employed to calculate relative fold change (2−∆∆Ct) in expression and standard error was calculated. The detail of primers used for qRT-PCR expression analysis is given in Supplementary Table S15 .
7
Total RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 0.5 g of frozen potato leaves using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions, and stored at −80 °C until use. RNA quality and concentration were determined using NanoPhotometer N60 (Implen, Munich, BY, Germany), and all RNA samples were diluted to 1 µg µL−1 in RNase-free water. The purity of RNA was gauged by the absorbance ratio of A260/A280. The integrity of isolated RNA was checked electrophoretically and assessed by the ratio of 28S/18S rRNA. The genomic DNA contamination was eliminated from the total RNA by DNase I treatment (Fermentas, Hanover, MD, USA), and the first-strand cDNA was synthesized from 3 µg of RNA using Revert Aid First Strand cDNA Synthesis Kit (Fermentas, Hanover, MD, USA) with oligo(dT) primers according to manufacturer’s instructions.
8
Bovine SLC2A2 mRNA Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from liver biopsy was extracted using Trizol (Invitrogen) according to the manufacturer’s protocol. After DNaseI treatment (Fermentas), RNA was quantified using a NanoDrop ND-1000 (NanoDrop Technologies) spectrophotometer, and RNA integrity determined by denaturing EtBr 1% agarose gel electrophoresis. Complementary DNA (cDNA) was synthesized using the First Strand cDNA Synthesis Kit (Fermentas).
SLC2A2 mRNA was examined by RT-PCR using primers 1F – CCTGGGCAATCACGAGCTAT and 1R - TCCAGCTGTCTGGAAAATGC, which hybridize to exon 6 and exon 8 and amplify a 370 bp product based on the mRNA reference sequence (NM_001103222) of bovine SLC2A2. RT-PCR was performed in 20 μl reaction volumes containing diluted first-strand cDNA equivalent to 50 ng input RNA. PCR products were loaded on 2% agarose gels. For Sanger sequencing, RT-PCR fragments were cloned into the pGEMT-easy PCR cloning vector.
SLC2A2 mRNA was examined by RT-PCR using primers 1F – CCTGGGCAATCACGAGCTAT and 1R - TCCAGCTGTCTGGAAAATGC, which hybridize to exon 6 and exon 8 and amplify a 370 bp product based on the mRNA reference sequence (NM_001103222) of bovine SLC2A2. RT-PCR was performed in 20 μl reaction volumes containing diluted first-strand cDNA equivalent to 50 ng input RNA. PCR products were loaded on 2% agarose gels. For Sanger sequencing, RT-PCR fragments were cloned into the pGEMT-easy PCR cloning vector.
9
RNA Extraction and Spike-in Normalization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Spike-in RNA (5′- CGAAAUUAAUACGACUCACUAUAGGGGAAUUGUGAGCGGAUAACUGACUGACUGACUAAAUAAUUUUGUUUAACUUUAAGAAGGAGAUAUACCA-3′) was produced using the RiboMAX Large-Scale RNA Production System-T7 (Promega) using a synthetic DNA template with a T7 promoter. The spike-in was purified using TRIzol (Ambion), according to the manual and quantified using a NanoDrop 2000 Spectrophotometer (Thermo).
Cells were harvested by centrifugation 8000 × g for 15 min at 4°C and resuspended in 1 mL TRIzol (Ambion). Spike-in RNA was added to each sample at 500 ng/(OD•mL). RNA extraction was then performed according to the product manual, with the modification that the RNA was precipitated overnight in isopropanol at -20°C. The remaining DNA was removed by DNaseI treatment (Fermentas), according to the product manual.
Cells were harvested by centrifugation 8000 × g for 15 min at 4°C and resuspended in 1 mL TRIzol (Ambion). Spike-in RNA was added to each sample at 500 ng/(OD•mL). RNA extraction was then performed according to the product manual, with the modification that the RNA was precipitated overnight in isopropanol at -20°C. The remaining DNA was removed by DNaseI treatment (Fermentas), according to the product manual.
10
Comparative Analysis of CAPN3 in Various Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The entire RNA isolated from muscle tissue, fibroblasts, buccal swab, and white blood cells (WBCs) of patients and healthy controls was processed using an RNeasy Mini Kit (QIAGEN, Venlo, The Netherlands) according to the manufacturer’s instructions. The RNA from each line underwent DNAse I treatment for 15 min at room temperature (Fermentas, Vilnius, Lithuania). For each sample, 1 µg of total RNA was reverse transcribed using ImProm-II™ Reverse Transcriptase (Promega, Madison, WI, USA) and random oligonucleotides in a 20 µL volume. As previously described [10 (link)], in order to analyze the entire coding region of CAPN3, the cDNA was amplified into five overlapping regions. We compare the cDNA with the CAPN3 human isoform 1 (NM_000070.2), and we used it for qualitative analysis. The total RNA isolated from urine samples of healthy controls was processed using the ZR Urine RNA Isolation Kit (Zymo Research, Irvine, CA, USA). The concentration and purity of total RNA samples were quantified using the QubitTM RNA IQ assay kit (Thermo Scientific, Waltham, MA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!