The largest database of trusted experimental protocols

Antibody to gapdh

Manufactured by Merck Group
Sourced in United States, Sao Tome and Principe, United Kingdom

Antibody to GAPDH is a laboratory reagent used for the detection and quantification of GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) protein in biological samples. GAPDH is a widely used housekeeping gene and its protein is involved in the glycolytic pathway. This antibody can be used in various immunoassay techniques, such as Western blotting, ELISA, and immunohistochemistry, to study the expression and localization of GAPDH in cells and tissues.

Automatically generated - may contain errors

9 protocols using antibody to gapdh

1

Murine Inflammatory Mediator Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Recombinant murine IL-1β and TNF were obtained from PeproTech (Rocky Hill, NJ, USA). Recombinant mouse macrophage colony-stimulating factor (M-CSF) was purchased from R&D Systems® (Minneapolis, MN, USA). Lipopolysaccharide (LPS), Pam3Csk4, and Poly(I:C) were purchased from InvivoGen (San Diego, CA, USA). Antibodies to c-Myc (9E10), TRADD (H278), ERK2 (D2) and β-tubulin (H235) were obtained from Santa Cruz Biotechnology®, Inc (Dallas, TX, USA). Antibodies specific for phospho-JNK/SAPK (Thr183/Tyr185), phospho-p44/42 MAPK (pERK) and phospho-IκB (Ser32/36) (5A5) were purchased from Cell Signalling Technology® (Danvers, MA, USA). Antibodies to Na+-K+ ATPase (ab69312) and green fluorescent protein (GFP; ab7671) were purchased from Abcam® (Cambridge, UK). Antibody to GAPDH was obtained from Sigma-Aldrich® (St. Louis, MO, USA).
+ Open protocol
+ Expand
2

Immunoblot Analysis of FLIP Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols
Immunoblot analysis was performed according to an established protocol (8 (link)). The expression of FLIP were recognized by incubation overnight at 4°C with rabbit monoclonal antibody to mouse FLIP (Cell Signaling Technology), followed by anti-rabbit secondary antibodies conjugated with horseradish peroxidase (GE healthcare). After stripping, the same membrane were blotted with antibody to GAPDH (Sigma-Aldrich) for loading adjustment. The specific proteins were detected employing the Enhanced Chemiluminescent Detection Reagent (Amersham Pharmacia).
+ Open protocol
+ Expand
3

Labeled Nitro-oleic Acid Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Labeled nitro-oleic acid ([13C]18NO2-OA) was provided by Professor Bruce Freeman from the University of Pittsburgh. EVOO was from the Frantoio variety and obtained from a first press extraction. EVOO was provided by Dr. Juan B. Barroso from Universidad de Jaén, Spain. Antibody to HO-1 was from StressGen Biotech and antibody to GAPDH was from Sigma Co (Saint Louis, MO). All solvents were of HPLC grade from Pharmco (Brookfield, CT). All other reagents were from Sigma Chemical Co (Saint Louis, MO) unless otherwise specified.
+ Open protocol
+ Expand
4

Fgr Gene Knockdown in Mouse Model

Check if the same lab product or an alternative is used in the 5 most similar protocols
Non-target control (sh-C018) and 3 shRNAs targeting mouse Fgr gene were purchased from (Sigma-Aldrich, St. Louis, MO) (shRNA #1, Clone ID: NM_010208.4-328s21c1, Sequence: CCGGACGG CTGAAGAACGCTATTTCCTCGAGGAAATAGCGTTCTTCAGCCGTTTTTTG; shRNA #2: Clone ID: NM_010208.2-758s1c1, Sequence: CCGGGCGATCACAT AAAGCATTATACTCGAGT ATAATGCTTTATGTGATCGCTTTTT and ShRNA #3, Clone ID: NM_010208.2-853s1c1 Sequence: CCGGCGGCACTACATGGAAGTGAATCTCGAGATTCACTTCCATGTAGTG CCGTTTTT), Rabbit anti-Fgr (# sc-74542) antibody was purchased from Santa Cruz Biotechnology, Inc and anti-phospho-Fgr antibody was purchased from the Invitrogen (Catalog # PA5-64583). Antibody to GAPDH was purchased from Sigma-Aldrich (St. Louis, MO). Antibody to collagen I was purchased from Abcam (Waltham, MA) (ab21286). TL02-59 was purchased from MedChemExpress as powder form (Cat. No.: HY-112852).
+ Open protocol
+ Expand
5

Caspase-3 Activation in Mouse Brain

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse brain samples ofindicated groups were lysed in RIPA buffer with protease inhibitors7 (link). Cleaved Caspase-3 (Asp175) antibody was purchased from Cell Signaling Technology13 (link), and antibody to GAPDH from Sigma.
+ Open protocol
+ Expand
6

DNAIC1 Protein Detection in Mouse Trachea

Check if the same lab product or an alternative is used in the 5 most similar protocols
Detection of Dnaic1 protein by Western blotting was performed using a mouse monoclonal antibody generated against a synthetic peptide from the human DNAI1 protein 18 (link) using standard procedures. For analysis of mouse tracheal epithelial cells, total cell lysates were prepared in Mammalian Protein Extraction Reagent (Pierce, Rockford, IL). Ciliary axonemes were isolated from cultured mouse tracheal epithelial cells as previously described 32 (link) and prepared in gel-loading buffer. For studies of protein turnover, both the soluble (cytoplasmic) and pellet (axonemal) fractions from individual cultures were analyzed. Protein samples were fractionated on 4 to 12% Bis-Tris gradient gels (Invitrogen, Carlsbad, CA), transferred to nitrocellulose membranes, and probed using Amersham ECL Plus reagents (GE Healthcare, Buckinghamshire, UK), all according to manufacturer's instructions. For normalization of loading, Western blots of cytoplasmic extracts were reprobed with an antibody to GAPDH (Sigma, St. Louis, MO), and axonemal pellets were reprobed with mouse anti-acetylated α-tubulin (Invitrogen). Quantification of signals was performed on an Odyssey Imaging System (Licor, Lincoln, NB).
+ Open protocol
+ Expand
7

DNAIC1 Protein Detection in Mouse Trachea

Check if the same lab product or an alternative is used in the 5 most similar protocols
Detection of Dnaic1 protein by Western blotting was performed using a mouse monoclonal antibody generated against a synthetic peptide from the human DNAI1 protein 18 (link) using standard procedures. For analysis of mouse tracheal epithelial cells, total cell lysates were prepared in Mammalian Protein Extraction Reagent (Pierce, Rockford, IL). Ciliary axonemes were isolated from cultured mouse tracheal epithelial cells as previously described 32 (link) and prepared in gel-loading buffer. For studies of protein turnover, both the soluble (cytoplasmic) and pellet (axonemal) fractions from individual cultures were analyzed. Protein samples were fractionated on 4 to 12% Bis-Tris gradient gels (Invitrogen, Carlsbad, CA), transferred to nitrocellulose membranes, and probed using Amersham ECL Plus reagents (GE Healthcare, Buckinghamshire, UK), all according to manufacturer's instructions. For normalization of loading, Western blots of cytoplasmic extracts were reprobed with an antibody to GAPDH (Sigma, St. Louis, MO), and axonemal pellets were reprobed with mouse anti-acetylated α-tubulin (Invitrogen). Quantification of signals was performed on an Odyssey Imaging System (Licor, Lincoln, NB).
+ Open protocol
+ Expand
8

Western Blotting for NUPR1 Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cells were lysed with RIPA lysis buffer (Millipore, Billerica, MA) containing a complete protease inhibitor tablet (Sigma). The protein concentration of tumor extracts was determined using BCA Protein Assay Kit (Pierce). Lysates were cleared by centrifugation at 14,000g for 20 min. The supernatant fractions were used for western blot. Protein extracts were resolved by 15% SDS-PAGE and probed with NUPR1(p8) Polyclonal Antibody (Cat #PA1–4177, ThermoFisher Scientific). Antibody to GAPDH (Millipore) was used as loading controls. The Ab binding was revealed using an HRP-conjugated anti rabbit IgG (1:3000, Cell Signaling), or anti-mouse IgG (1:3000, Amersham Pharmacia Biotech, Piscataway, New Jersey, USA). Antibody complexes were detected by SuperSignal West Pico Chemiluminescent Substrate or SuperSignal West Dura Extended Duration Substrate (Thermo Scientific) and ChemiDoc Imaging System (Bio-Rad, Hercules, CA).
+ Open protocol
+ Expand
9

Phosphorylation of 4E-BP1 in Cell Death

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tissue culture reagents were supplied by Sigma, Poole, UK. Antibody to 4E-BP1 (R113) was from Santa Cruz Biotechnology, CA, USA. Antibodies against phosphorylated 4E-BP1 (anti-Ser65 catalogue number 9451, anti-Thr37/46 catalogue number 9459 and anti-Thr70 catalogue number 9455), caspase-8, biotinylated gel markers and cell lysis buffer were all from Cell Signalling Technology, Hitchin, UK. Mouse anti-PARP was purchased from BD Pharmingen, Oxford, UK. The antibody to GAPDH was from Millipore, Watford, UK. All secondary antibodies (anti-rabbit-horseradish peroxidase (HRP) linked, anti-mouse-HRP linked or anti-biotin-HRP linked) were obtained from Cell Signalling Technology. Polyvinylidene fluoride (PVDF) membrane and rainbow markers were supplied by GE Healthcare, Amersham, UK. Immobilised m7GTP-Sepharose was from Jena Biosciences, Jena, Germany. Human TRAIL was from PeproTech EC Ltd, London, UK. MTT was from Sigma.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!