Dntp mix

The Plasmid Extraction Kit (D6950-02, Omega Bio-Tek, Norcross, GA, USA), RNAi-Mate Transfection Reagent (Gima Genetics, China, G04001), phosphate buffer saline (PBS) (Solarbio, China, P1010), sodium pentobarbital (P3761, Sigma Merck, Germany), eosin (E8090, Solarbio, China), hematoxylin (G1004, Servicebio, China), neutral resin (G8590, Solarbio, China), nisin staining solution (G1036, Servicebio, China), TRIzol (15596026, Ambion, USA), SYBR FAST quantitative polymerase chain reaction Master Mix (KM4101, KAPA Biosystems, China), Oligo (dT) 18 Primer (3806, TAKARA, Japan), PrimeScript II Rtase (TAKARA, Japan, 2690A), Recombinant Rnase Inhibitor (TAKARA, Japan, 2313A), 10 mM dNTP Mix (PC2200, Solarbio, China), In Situ Cell Death Detection Kit (11684817910, ROCHE, Switzerland), DAB Concentrated Kit (DA1010-2 × 3 ml, Solarbio, China), Opti-MEM (31985-062, Gibco), Lipofectamine 2000 (11668-027, Invitrogen, USA), Dual luciferase reporter gene assay kit (RG027, Biyuntian, China), caspase-9 (PAB40626, Bioswamp, China), caspase-3 (PAB30047, Bioswamp, China), BCL2-Associated X (Bax) (PAB46088, Bioswamp, China), B-cell lymphoma-2 (Bcl-2)(PAB30041, Bioswamp, China), glyceraldehyde-3phosphate dehydrogenase (GAPDH) (PAB36269, Bioswamp, China), and Goat anti-Rabbit IgG (SAB43714, Bioswamp, China) were employed in this study. A flowchart of this study is shown in Figure 1.

The total RNA was extracted from brain tissue using 1 mL Trizol reagent (Icosai Biotechnology, MB000) and reverse-transcribed into cDNA using ReverTra Ace qPCR RT Master Mix (Thermo Fisher Scientific, K1612). In order to perform RT-qPCR, dNTP mix (Solarbio, PC2200) was used, along with the Roche LightCycler 480 Real-Time PCR System. Data were analyzed using the Light Cycle 96 SW1.1 software by the 2^−ΔΔCt method. The primers used for RT-qPCR were synthesized by Sangon Biotech (China), and the sequences were as follows: GABAAR4α-F (5′–3′): GAAACCACTCCTAAGGCCCACT, GABAAR4α-R (5′–3′): GCGATGCGGCAGACGAAA, GAPDH-F (5′–3′): TCTCTGCTCCTCCCTGTTCT, GAPDH-R (5′–3′): TACGGCCAAATCCGTTCAC.

The microRNAs, the padlock probe and DNAzyme, were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). T4 DNA ligase, phi29 DNA polymerase, exonuclease I (EXO I), ribonuclease inhibitor, BSA, (NH4)₂SO₄, and Tris-buffer solution (1 mol L⁻¹; pH 8.0) were purchased from Sangon Biotech Co., Ltd. (Shanghai, China). dNTP mix (25 mmol L⁻¹ each) was purchased from Solarbio. Cell culture-grade ultrapure water was purchased from KeyGEN BioTECH. Magnesium chloride was purchased from Shanghai Macklin Biochemical industry (Shanghai, China). The sequences of nucleic acids employed in this study are given in Table 1 in the Supporting Information.