Mission plko 1 puro non mammalian shrna control

Lentiviral vectors containing short hairpin RNA (shRNA) targeting human fascin (FSCN1 MISSION^® shRNA Lentiviral Transduction Particles-SHCLNV-NM_003088) or scrambled control shRNA (MISSION^® pLKO.1-puro Non-Mammalian shRNA Control) were prepared by Sigma-Aldrich (USA). SCC-15 and HSC-3 cells grown in a 12-well plate at confluence of 70% were incubated with control or fascin shRNA lentiviral particles at a multiplicity of infection (MOI) of 1.5 in culture media containing 8 mg/ml of polybrene (Sigma-Aldrich, USA) for 4 h. After washing with PBS, cells were cultured in fresh media for an additional period of 48 h. Cells were then cultured for 10 days in the presence of 1 μg/ml of puromycin dihydrochloride (Sigma-Aldrich, USA) to select resistant cells. The efficacy of fascin knockdown was determined by qPCR and western blot.

Stable TAGLN2 Knock-down: Short hairpin RNA (shRNA) targeting TAGLN2 were transfected into cells using Lipofectamine 2000 (ThermoFisher Scientific, Waltham, MA) per the manufacturer’s protocol and TAGLN2 knock-down efficiency was measured 48 hours after transfection. For GBM30 cells, shRNA targeting TAGLN2 was purchased from Origene with the following sequences: shRNA#1: CTGTGTGCAGCGGACGCTGATGAATCTGG and shRNA#2: GGCGTCTCAGGCAGGCATGACTGGCT ACG. Control cells were transfected with scrambled shRNA control in the pGFP-V-RS shRNA vector (Origene, Rockville, MD). shRNA #3 targeting human TAGLN2 was purchased from Sigma and transfected into U87 MG cells with the following sequence: CCGGGAACGTGATCGGGTTACAGATCTCGAGATCTGTAACCCGATCACGTTCTTTTTTG (Sigma, St. Louis, MO). Transfection with MISSION pLKO.1-puro Non-Mammalian shRNA Control Plasmid DNA was used for the corresponding scrambled shRNA control (Sigma, St. Louis, MO). Different TAGLN2-targeted shRNAs with greater knock-down efficiency were required for GBM30 cells due to their lower transfection rates. Stable cell lines were maintained in selection media supplemented with puromycin (2 μg/mL) (Sigma, St. Louis, MO).