We sequenced the above genes from the 12 D. pseudoobscura Mesa Verde lines using standard polymerase chain reaction (PCR) and Sanger sequencing methods (Haddrill et al. 2010 (link)). A complete list of the PCR primers as well as the cycling conditions used for each gene are available on request. PCR-amplified products were treated with ExoSAP-IT (USB, Cleveland, OH) and sequenced from both strands using BigDye chemistry and a 3730 automated sequencer (Applied Biosystems, Foster City, CA) at the University of Edinburgh GenePool sequencing service, with PCR primers used as sequencing primers. Not all genes were sequenced from all strains; the average number of strains sequenced per gene was 11 (see supplementary table S6 , Supplementary Material online). Sequences have been submitted to the GenBank database under the accession numbers JX409935–JX411616.
3730 automated sequencer
Manufactured by Thermo Fisher Scientific
Sourced in United States
The 3730 automated sequencer is a high-performance DNA sequencing instrument designed for accurate and efficient genetic analysis. It utilizes capillary electrophoresis technology to separate and detect fluorescently labeled DNA fragments, enabling rapid and sensitive DNA sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Topo2, by Thermo Fisher Scientific (1 mentions)
C1000 thermal cycler, by Bio-Rad (1 mentions)
Taq polymerase, by Promega (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Revertra ace qpcr rt kit, by Toyobo (1 mentions)
Exosap it, by Thermo Fisher Scientific (1 mentions)
Sequencher 4, by Gene Codes (1 mentions)
Gel extraction kit, by Bio Basic (1 mentions)
Plasmid miniprep kit, by Thermo Fisher Scientific (1 mentions)
7 protocols using 3730 automated sequencer
1
Sanger Sequencing of D. pseudoobscura Genes
2
Identification and Characterization of NlHR3 and NlFTZ-F1 Genes in N. lugens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Based on the published N. lugens genomic and transcriptomic data (Xue et al., 2014 (link); Wan et al., 2015 (link)), NlHR3 and NlFTZ-F1 homologies were identified and their sequences were confirmed by the reverse transcription polymerase chain reaction (RT-PCR) using primers, as shown in Supplementary Table S1 . The PCR product was gel purified, ligated into the vector TOPO2.1 (Invitrogen, Carlsbad, CA), and transformed into Escherichia coli DH5α competent cells (Novagen, Darmstadt, Germany). A total of 10 recombinant plasmids from several independent subclones were fully sequenced on the Applied Biosystems 3730 automated sequencer (Foster City, CA) from both directions. The newly described transcript variants of NlHR3 and NlFTZ-F1 were submitted to GenBank.
ClustalW2 was used to perform a homologous sequence alignment of HR3 and FTZ-F1 proteins from Nilaparvata lugens, Drosophila melanogaster, Tribolium castaneum, Bombyx mori, Apis mellifera, Aedes aegypti, Pediculus humanus corporis, Blattella germanica, and Acyrthosiphon pisum (Larkin et al., 2007 (link)). The conserved domains were predicted by using the Simple Modular Architectural Research Tool (SMART;http://smart.embl-heidelberg.de/ ) and InterPro: protein sequence analysis and classification (http://www.ebi.ac.uk/interpro/ ).
ClustalW2 was used to perform a homologous sequence alignment of HR3 and FTZ-F1 proteins from Nilaparvata lugens, Drosophila melanogaster, Tribolium castaneum, Bombyx mori, Apis mellifera, Aedes aegypti, Pediculus humanus corporis, Blattella germanica, and Acyrthosiphon pisum (Larkin et al., 2007 (link)). The conserved domains were predicted by using the Simple Modular Architectural Research Tool (SMART;
3
PCR Amplification and Sequencing of EXOV and EXOVL
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The new gene EXOV and the parental gene EXOVL were PCR amplified from genomic DNA in four separate reactions using the primer pairs in Supplemental Table S5 . Following PCR, the amplified products were sequenced from both strands using each gene-specific primer, BidDye chemistry, and a 3730 automated sequencer (Applied Biosystems).
4
Sequencing the δ-Globin Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As previously described by Dongzhi Li et al, two pairs of primers were designed to sequence the δ‐globin gene.6 The first amplified fragment (897 bp) was from position −219 of the cap site to +678 (Forward primers 5′‐AGA TGC GGT GGG GAG ATA‐3′ and reverse primers 5′‐TAG CAA GAT TGT GAG GAA GGA A‐3′). The second fragment (470 bp) was from position +1310 to +1779 (Forward primers 5′‐GGG TGT TGG CTC AGT TTC‐3′ and reverse primers 5′‐GTA CGG TTC CCT TGC TTT‐3′). DNA was amplified using Taq polymerase (Promega) in C‐1000 Thermal Cycler (Bio‐Rad). PCR was performed in 50 µL‐reaction including 0.5 U La Taq polymerase with an annealing temperature of 62°C for 1 minutes and 30 cycles. The PCR products were sequenced by the 3730 automated sequencer (Applied Biosystems).
5
Transcriptional Evidence of NlbHLH Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to get transcriptional evidence of the genes, reverse transcription polymerase chain reaction (RT-PCR) was performed to authenticate the sequences of genes or fragments. Total RNA was extracted from eggs, first-instar through fifth-instar nymphs, and newly emerged adults (within 24 h after molting) using the Trizol Reagent (Invitrogen, Shanghai, China) according to the manufacturer’s instructions. These total RNA samples were pooled. The concentration and purity of the pooled sample were measured with the NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific, Rockford, IL, USA) and the integrity was checked by agarose gel electrophoresis. One microgram (μg) of the total RNA was reverse transcribed to cDNA using the ReverTra Ace qPCR RT Kit (Toyobo Co. Ltd., Osaka, Japan). The cDNA was used to perform polymerase chain reaction (PCR) to verify the candidate NlbHLHs using primers listed in Table 1 . The PCR product was sequenced on the Applied Biosystems 3730 automated sequencer (Foster City, CA, USA) from both directions (Additional file 2 ). The sequences were aligned with N. lugens genome to show their identities.
6
Sequencing of MtnA genomic region
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Approximately 6 kb of the MtnA genomic region, spanning from the second intron of CG12947 to the 3’ UTR of CG8500 (genome coordinates 3R: 5,606,733–5,612,630), were sequenced in 12 Dutch, 11 Zimbabwean and 12 Swedish lines (Fig 1 ). The following primer pairs were used (all 5’ to 3’): GATGGTGGAATACCCTTTGC and AAAGCGGGTTTACCAGTGTG; GTTGGCCTGGCTTAATAACG and ACTGGCACTGGAGCTGTTTC; GCTCTTGCTAGCCATTCTGG and AGAACCCGGCATATAAACGA; GATATGCCCACACCCATACC and GTAGAGGCGCTGCATCTTGT; CACTTGACCATCCCATTTCC and CAAGTCCCCAAAGTGGAGAA; CTTGATTTTGCTGCTGACCA and ATCGCCACGATTATGATTGC; CAGGACAATCAAGCGGAAGT and TTATGAAGCGCAGCACCAGT; GACCCACTCGAATCCGTATC and TGCTTCTTGGTGTCCAGTTG. PCR products were purified with ExoSAP-IT (Affymetrix, Santa Clara, CA, USA) and sequenced using BigDye chemistry on a 3730 automated sequencer (Applied Biosystems). Trace files were edited using Sequencher 4.9 (Gene Codes Corporation, Ann Arbor, MI, USA) and a multiple sequence alignment was generated using the ClustalW2 algorithm in SeaView (version 4) [61 (link)]. All sequences have been submitted to GenBank/EMBL under the accession numbers KT008059–KT008093.
7
Genomic DNA Extraction and Plasmid Manipulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers used in this study are shown in Table S1. Genomic DNA was isolated using the 5′ ArchivePure DNA kit (5 Prime, Gaithersburg, MD). PCR products and plasmids were purified using a commercially available gel extraction kit (Bio Basic Inc., Markham, Ontario) and a plasmid miniprep kit (Fermentas, Glen Burnie, MD) respectively. Restriction endonucleases and DNA modification enzymes were purchased from New England Biolabs (Beverly, MA). Standard methods for the manipulation of plasmids and DNA fragments were followed (Sambrook et al., 1989) . Sequences of all cloned PCR products were verified at the University of California Davis Sequencing Facility using fluorescent automated DNA sequencing with an Applied Biosystems 3730 automated sequencer.
Escherichia coli strains were transformed with plasmid DNA (Sambrook et al., 1989) , and plasmids were mated into P. putida strains by conjugation in the presence of E. coli HB101(pRK2013) (Simon et al., 1983) . Exconjugants were selected on MSB plates containing 10 mM succinate and the appropriate antibiotic. Deletion mutants that arose from double-crossover events were isolated by counterselection in MSB containing 10 mM succinate and 20% sucrose. Mutants were screened for antibiotic sensitivity to confirm the loss of plasmid, and deletions were verified by PCR using the appropriate primers (Table S1).
Escherichia coli strains were transformed with plasmid DNA (Sambrook et al., 1989) , and plasmids were mated into P. putida strains by conjugation in the presence of E. coli HB101(pRK2013) (Simon et al., 1983) . Exconjugants were selected on MSB plates containing 10 mM succinate and the appropriate antibiotic. Deletion mutants that arose from double-crossover events were isolated by counterselection in MSB containing 10 mM succinate and 20% sucrose. Mutants were screened for antibiotic sensitivity to confirm the loss of plasmid, and deletions were verified by PCR using the appropriate primers (Table S1).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!