Pnlf1 n

The synthetic full-length p35 gene of ASFV (Pig/HLJ/18strain) (Shi et al., 2021 (link)), was amplified with the primers (p35F:5′-GCGAATTCATGGGGAATGACCCGCCGGT-3′, p35R: 5′-CCTCTAGATTAATGGTGATGGTGATGATGCCCCCCTA-3′) including the EcoRI and XbaI restriction enzyme sites (underlined), and the amplified fragment was subsequently purified and cloned into the secreted luciferase expression vector pNLF-1-N (Promega, USA) by the restriction enzyme sites of EcoRI and XbaI. The pNLF-1N-p35 recombinant plasmids were verified by sequencing. The amount of 1 μg pNLF-1N-p35 plasmids were transfected into 2 × 10⁵ HEK 293 T cells using lipofectamine™ 2000 transfection reagent (Invitrogen) according to the manufacturer’s instructions. Thirty-six hours after transfection, the 293T cells transfected with the pNLF-1N-p35 recombinant plasmids were lysed in ice-cold RIPA buffer, the cell lysates was then centrifuged at 10,000 g for 5 min at 4 °C to collect the supernatant. The p35-Luc fusion protein was verified via Western blotting with the inactivated ASFV-positive serum kept in our lab (Shi et al., 2021 (link)). In addition, the specificity of the p35-Luc fusion protein was determined by detecting of the sera raised against three swine pathogens including PRRSV, CSFV and PCV2 via Western blotting. The supernatants were harvested and stored at −20 °C till use.

The recombination expression plasmid pNLF-P (Figure 1A) was constructed using the luciferase expression vector pNLF1-N (Promega, USA). Fragments of the norovirus GII.6 P domain (NCBI Accession no. MT861044) were amplified from the plasmid pGEX-4T-GII.6P through PCR, employing the following primers: 5′ CCGGAATTCTCAAAGACTAAGCCCTTTAC−3′ and 5′- TAAAGCGGCCGCTTAGCAAAAGCAATCGC−3′. The genome structure of NoV can be found in Supplementary Figure 1. The PCR was carried out under the following conditions: pre-denaturation at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, and a final extension at 72°C for 10 min. Subsequently, the PCR products were inserted into the EcoRI-NotI-cut pNLF1-N vector after double digestion with EcoRI and NotI restriction enzymes (Takara Biotechnology Co., Ltd, China). The resulting recombinant plasmids were verified through DNA sequencing to confirm the absence of PCR-induced errors and were used for cell transfection.

Site-directed mutagenesis was performed on full-length human alternative transcript variant 17 CACNA1C (NM_001129843) cloned into the pCMV6-XL4 vector (Origene Technologies) using the QuickChange II XL kit (Agilent Technologies). Human CACN2B (NM_201572) was cloned into the pCMV6-XL5 vector (Origene Technologies). For the Nano-Luciferase assay, WT and mutant Ca_vα1.2 cDNAs were cloned into the pNLF1-N vector (Promega), whereas for the BRET assay, Ca_vα1.2 and Ca_vβ2 cDNAs were cloned into the pNLF1-N and HaloTag-pFN21A vectors, respectively. All clonings were performed using the In-fusion HD Cloning Plus kit (Clontech). All constructs were verified by sequencing of the complete insert. Peptides were synthetized by GenScript (USA). R7W-MP: RRRRRRRW-DQRPDREAPRS; R7W-Scr: RRRRRRRW-DQPPSRRDERA.