The largest database of trusted experimental protocols

Green premix ex taq 2 tli rnaseh plus

Manufactured by Takara Bio
Sourced in Japan

Green Premix Ex Taq II (Tli RNaseH Plus) is a master mix designed for PCR amplification. It contains a thermostable DNA polymerase, dNTPs, and a proprietary buffer system. The mix is pre-colored with a green dye to facilitate pipetting and visualization during electrophoresis.

Automatically generated - may contain errors

4 protocols using green premix ex taq 2 tli rnaseh plus

1

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from each group in vitro and in vivo using an RNA Quick Purification kit (ESscience, China). RNA was reverse transcribed into cDNA using PrimeScriptTM RT Master Mix (Perfect Real Time) (Takara, Japan), and RT–PCR was performed with Green Premix Ex Taq II (Tli RNaseH Plus) (Takara, Japan). The related primers were designed and synthesized by Shanghai Biotech Co., Ltd. and were listed in the key resources table. The relative expression levels were calculated and analyzed using the 2−ΔΔCt method. Among them, the experiment in vitro was repeated three times independently, and the results were used for subsequent statistical analysis. Besides, MTM and MCM tissues were collected from 1 eye of the negative control group and 1 eye of the experimental group, the experiment was repeated three times for subsequent statistical analysis.
+ Open protocol
+ Expand
2

Quantitative RT-PCR Analysis of Antigen Presentation Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNAs were extracted using the RNeasy mini kit (74106, QIAGEN), and reverse transcription reactions were performed using the Prime Script RT reagent Kit with gDNA Eraser (Perfect Real Time) (RR047A, Takara). After mixing the generated cDNA templates with primers/probes and Green® Premix Ex Taq™ II (Tli RNaseH Plus) (RR820B (A × 2), Takara), reactions were performed with the Step One Plus TM Real-Time PCR System (Applied Biosystems).
Mouse GAPDH: Forward, 5′-AGGTCGGTGTGAACGGATTTG-3′,
Reverse, 5′-GGGGTCGTTGATGGCAACA-3′;
Mouse Tap1: Forward, GGACTTGCCTTGTTCCGAGAG,
Reverse, GCTGCCACATAACTGATAGCGA;
Mouse Tap-2: Forward, CTGGCGGACATGGCTTTACTT,
Reverse, CTCCCACTTTTAGCAGTCCCC;
Mouse Tap-bp: Forward, GGCCTGTCTAAGAAACCTGCC.
Reverse, CCACCTTGAAGTATAGCTTTGGG.
Mouse Erap1: Forward, TAATGGAGACTCATTCCCTTGGA.
Reverse, AAAGTCAGAGTGCTGAGGTTTG.
+ Open protocol
+ Expand
3

Real-Time PCR Analysis of IκBα Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Forty-eight hours after transfection, the total RNA was extracted from each group by using RNA Quick Purification kit (ESscience, China). The concentration and purity of RNA samples were determined by UV spectrophotometry. The total RNA of each group was reversely transcribed to generate cDNA with PrimeScript™ RT Master Mix (Perfect Real Time) (Takara, Japan). Real-time PCR was performed on IκBα and ACTB (internal control) with Green Premix Ex Taq II (Tli RNaseH Plus) (Takara, Japan). The PCR reaction conditions were as follows: predenaturation at 95°C for 30 seconds, denaturation at 95°C for 5 seconds, and annealing at 60°C for 30 seconds, for a total of 40 cycles. Cynomolgus monkey IκBα and ACTB primers were designed and synthesized by Shanghai Biotech Co., Ltd, China, and homology analysis was performed on BLAST. Primer sequence of I-κBα: F:5′-CTGGTGTCGCTCCTGTTGAAGTG-3′, 23 bp; R:5′-TGTCATAGCTCTCCTCATCCTCACTC-3′, 26 bp; internal reference ACTB: F:5′-AGATCAAGATCATTGCTCCTCCTG-3′, 24 bp; R:5′-TCACAGTCCGCCTAGAAGCA-3′, 20 bp. The relative expression level of the IκBα gene mRNA was calculated and analyzed by the 2−ΔΔCt method.
+ Open protocol
+ Expand
4

Real-Time RT-PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
First strand cDNA was synthesized from 2 μg total RNA using PrimeScriptTM RT reagent Kit using gDNA Eraser (Perfect Real Time) (Takara). Real-time RT-PCR was performed with Green® Premix Ex Taq™ II (Tli RNaseH Plus) (TaKaRa) on a Bio-Rad CFX Connect. The relative expression level was normalized to EF1α by the 2−ΔΔCT method [69 (link),70 (link)]. Primers are listed in Table S2.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!