Custom made primers

Total RNA was extracted by Trizol Reagent (Takara, Shiga, Japan) and the first strand synthesis kit (Takara, Shiga, Japan) was used for reverse‐transcription reaction to prepare cDNA samples. The quantitative real‐time PCR (qRT‐PCR) was conducted by SYBR Green reagents (Takara, Shiga, Japan) on LightCycler 480 real‐time PCR system (Roche Life Science, Basel, Switzerland). The expression of beta‐actin was used as internal control for the normalization of targeted genes’ expression. The custom‐made primers (Life Technologies, Carlsbad, CA, USA) for RT‐PCR analysis are as follows: LDHA (h, human) forward: CCCCAGAATAAGATTACAGTTGTTG, LDHA(h) reverse: GAGCAAGTTCATCTGCCAAGTC; LDHA(m, mouse) forward: CTGGCTCCAGTGTGTACGTC, and LDHA(m) reverse: TGGGTGGTTGGTTCCATCAT; β‐actin(h) forward: CTACGTCGCCCTGGACTTCGAGC; and β‐actin(h) reverse: GATGGAGCCGCCGATCCACACGG; and β‐actin(m) forward:  TGTCCACCTTCCAGCAGATGT, β‐actin(m) reverse: AGCTCAGTA ACAGTCCGCCTAG.

DMEM/F-12 growth medium, Glutamax, Hu IL-8 Cytoset ELISA kit, PureLink Genomic DNA mini kit, Quant-iT RNA BR assay kit, NuPAGE Novex 4–12% Bis-Tris gel, TRIzol reagent, DNAse1-RNAse-free (AM2222), Superscript III reverse transcriptase, RNAseOUT recombinant Ribonuclease inhibitor, dNTP, DTT, aprotinin, Lipofectamine, microAMp optical 384 well reaction plate, custom-made primers, and 1 kb plus DNA ladder were purchased from Life Technologies (Burlington, ON, Canada). Normocin was obtained from InvivoGen (San Diego, CA, USA). ATP, ADP, AMP, adenosine, ATP-γ-S, suramin, diadenosine pentaphosphate (Ap₅A), malachite green, and random nonamers (R7647) were purchased from Sigma. Millex GP syringe-driven filter unit 0.22 µm and Immobilon-P membrane were from Millipore (Billerine, MA, USA). Hank's balanced salt solution (HBSS) with Ca²⁺ and Mg²⁺, Hepes, and antibiotic-antimycotic solutions was from Wisent (St. Bruno, QC, Canada). RNeasy mini kit and QuantiTect Reverse Transcription kit were from Qiagen (Mississauga, ON, Canada). Taq polymerase was obtained from New England Biolabs (Ipswich, MA, USA) and FastStart Universal SYBR Green Master (Rox) was from Roche (Mannheim, Germany).

Total RNA was extracted, using the miRNeasy Plus Mini Kit (Qiagen, Hilden, Germany) manufacturer protocol. UGT1A1, 1A6, 1A9, and 2B7, expression levels were determined via qRT‐PCR using GAPDH as an endogenous control. RNA quantification and quality were assessed, using optical spectrometry ratios (260/280 and 260/230 nm); mRNA was reverse transcribed to cDNA using the iScript Reverse Transcription Kit (Bio‐Rad, Hercules, CA) and diluted to obtain 25 ng/mL final cDNA concentration. Here, qRT‐PCR was performed on an Applied Biosystems Quantum Studio Viia 7 system with iTaq Universal SYBR Green (Bio‐Rad) and custom made primers (Life Technologies). The thermocycler parameters were 95°C for 30 seconds, then 40 cycles consisting of 95°C for 15 seconds followed by an annealing temperature for 30 seconds. Primer sequences and annealing temperatures are provided in Table S1. The delta–‐delta C_T method was applied to determine the relative expression of each gene for rifampin and vehicle‐treated cells as previously described.5 The fold change in gene expression is represented as the mean ± SEM of the biological replicates (n = 4).