The following constructs were obtained from Addgene: H2B-eGFP (plasmid 11680, from G. Wahl), emerin-eGFP (plasmid 61985, from E. Schirmer), pmRFP-LAP2β-IRES-puro2b (plasmid 21047, from D. Gerlich). The construct encoding eGFP-BAF was made by recombining full-length human BAF into pLenti-CMV-neo-eGFP vector (T. Kuroda, vector plasmid Addgene 17447, from E. Campeau and P. Kaufman). The construct encoding mRFP-H2B was generated by recombining mRFP-H2B into pBABE-Puro vector (T. Kuroda, vector plasmid Addgene 1764, from H. Land, J. Morgenstern and B. Weinberg). The construct encoding TDRFP-NLS (referred to as RFP-NLS throughout the manuscript) was a gift from A. Salic. The construct encoding mNeonGreen-PCNA was made by recombining mNeonGreen-PCNA into pLENTI CMV Neo DEST vector (N. Umbreit, vector plasmid Addgene 17392, from E. Campeau and P. Kaufman) using Gateway LR Clonase II Enzyme (Invitrogen). Before Gateway cloning (Invitrogen), mNeonGreen-PCNA was first amplified by PCR using Ex Taq polymerase (Takara, primers: Forward 5’ CACCATGGTGAGCAAGGG 3’; Reverse 5’ CCTCTACAAATGTGGTATGGCTG 3’) and then the resulting PCR product was inserted into the pCR8/GW/TOPO vector (Invitrogen), according to the manufacturer’s instructions.
H2b egfp
Manufactured by Addgene
The H2B-eGFP is a histone H2B protein fused to enhanced green fluorescent protein (eGFP). This fusion protein allows visualization of chromatin dynamics and chromosome behavior in living cells.
Automatically generated - may contain errors
Lab products found in correlation
Pcr8 gw topo vector, by Thermo Fisher Scientific (2 mentions)
Emerin egfp, by Addgene (2 mentions)
Pmrfp lap2β ires puro2b, by Addgene (2 mentions)
Plenti cmv neo dest vector, by Thermo Fisher Scientific (2 mentions)
Gateway lr clonase 2 enzyme, by Thermo Fisher Scientific (2 mentions)
Gateway cloning, by Thermo Fisher Scientific (2 mentions)
Ex taq polymerase, by Takara Bio (2 mentions)
Tdtomato, by Addgene (1 mentions)
Tamoxifen tmx, by Merck Group (1 mentions)
High glucose medium, by Thermo Fisher Scientific (1 mentions)
H2b mcherry, by Addgene (1 mentions)
Pultra, by Addgene (1 mentions)
Pultra hot, by Addgene (1 mentions)
Pspax2, by Addgene (1 mentions)
Pmd2 g, by Addgene (1 mentions)
Polyethylenimine (pei), by Polysciences (1 mentions)
5 protocols using h2b egfp
1
Fluorescent Protein Expression Constructs
2
Generation of loxP-flanked Mafb conditional KO mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We generated loxP-flanked Mafb conditional KO mice (Mafbp/p, Supplementary Fig. 6b ). Pdgfb-iCre transgenic mice were bred into a background of RiboTag (Rpl22HA/HA), and/or Mafbp/p mice. To induce Cre-mediated gene recombination, tamoxifen (Tmx; T5648; Sigma-Aldrich) was dissolved in 100% ethanol, further diluted with peanut oil, and then intraperitoneally injected at P1–P3 for early induction (50 μl of 1 mg/ml Tmx per day) or at P5–P8 for late induction (50 μl of 2 mg/ml Tmx per day), respectively. Tmx-injected Mafbp/p littermates were always used as controls. Cdh5-EGFP transgenic mice were generated by pronuclear injection into fertilized mouse oocytes. The injected construct consists of a cDNA encoding membrane-tagged tdTomato (Addgene plasmid # 17787), 2A peptide, AU1 tag, and H2B-EGFP (Addgene plasmid # 11680) introduced by homologous recombination into the start codon of Cdh5 in PAC clone 353-G15. All mice were maintained on the C57BL/6 background.
All animal experiments were performed in compliance with the relevant laws and institutional guidelines, approved by local animal ethics committees, and conducted with permissions granted by the Landesamt für Natur, Umwelt und Verbraucherschutz (LANUV) of North Rhine-Westphalia, Germany.
All animal experiments were performed in compliance with the relevant laws and institutional guidelines, approved by local animal ethics committees, and conducted with permissions granted by the Landesamt für Natur, Umwelt und Verbraucherschutz (LANUV) of North Rhine-Westphalia, Germany.
3
Fluorescent Protein Expression Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following constructs were obtained from Addgene: H2B-eGFP (plasmid 11680, from G. Wahl), emerin-eGFP (plasmid 61985, from E. Schirmer), pmRFP-LAP2β-IRES-puro2b (plasmid 21047, from D. Gerlich). The construct encoding eGFP-BAF was made by recombining full-length human BAF into pLenti-CMV-neo-eGFP vector (T. Kuroda, vector plasmid Addgene 17447, from E. Campeau and P. Kaufman). The construct encoding mRFP-H2B was generated by recombining mRFP-H2B into pBABE-Puro vector (T. Kuroda, vector plasmid Addgene 1764, from H. Land, J. Morgenstern and B. Weinberg). The construct encoding TDRFP-NLS (referred to as RFP-NLS throughout the manuscript) was a gift from A. Salic. The construct encoding mNeonGreen-PCNA was made by recombining mNeonGreen-PCNA into pLENTI CMV Neo DEST vector (N. Umbreit, vector plasmid Addgene 17392, from E. Campeau and P. Kaufman) using Gateway LR Clonase II Enzyme (Invitrogen). Before Gateway cloning (Invitrogen), mNeonGreen-PCNA was first amplified by PCR using Ex Taq polymerase (Takara, primers: Forward 5’ CACCATGGTGAGCAAGGG 3’; Reverse 5’ CCTCTACAAATGTGGTATGGCTG 3’) and then the resulting PCR product was inserted into the pCR8/GW/TOPO vector (Invitrogen), according to the manufacturer’s instructions.
4
Induction of Chromatin Compaction and Loosening in NIH3T3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NIH3T3 cells were grown in high glucose medium from Invitrogen, supplemented with 10% Fetal Bovine Serum, 5 ml of Pen-Strep and HEPES at 37°C and in 5% CO2. Freshly split cells were plated onto 35-mm glass bottom dishes coated with fibronectin and then, after twenty four hours, transiently transfected with EGFP, H2B-EGFP (Plasmid #11680 purchased from Addgene), HP1α-EGFP (Plasmid #17652 purchased from Addgene) or HP1α-I165E-EGFP (kindly provided by Professor Lori Wallrath). Freshly split cells were plated onto MatTek 35-mm glass bottom dishes coated with 3 μg/mL fibronectin and then transiently transfected with one of the EGFP tagged plasmids using Lipofectamine 2000 according to manufacturer’s protocol. Induction of chromatin compaction was carried out by treating the NIH3T3 cells transiently transfected with HP1α with Actinomycin D (5 μg/ml, a concentration known to stop class III transcription) for 5–10 minutes. Induction of chromatin loosening was carried out by treating the NIH3T3 cells transiently transfected with HP1α with sodium butyrate (10 mM, a concentration known to inhibit Histone Deacetylase, HDAC) for 1–4 hours35 (link).
5
Engineered Plasmids and Lentivirus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids pUltra (#24129) and pUltra-hot (#24130) were purchased from Addgene. The eGFP and mCherry alleles were replaced with H2B-eGFP and H2B-mCherry from Addgene plasmids #11680 and #20972, respectively. Human and mouse PAQR8 cDNA sequences were synthesized by Integrated DNA Technologies, sequence-verified, and cloned into the above-modified pUltra plasmid. Sense and anti-sense oligos for each sgRNA were ligated into BsmB1-digested LRG2.1 vector (Addgene #108098) or LRmCherry2.1 vector (Addgene #108099). Lentivirus was produced by transfecting HEK293T cells with polyethylenimine (Polysciences #23966), pMD2.G (Addgene #12259), psPAX2 (Addgene #12260), and the plasmid of interest.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!