Rabbit anti-SQSTM1 is a primary antibody that recognizes the SQSTM1 (Sequestosome-1) protein. SQSTM1 is a multifunctional adaptor protein involved in various cellular processes.
Total RNA of liver tissues was isolated with the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Eight hundred nanograms total RNA was reverse-transcribed into cDNA using the PrimeScript RT reagent Kit (Takara, Tokyo, Japan) following the manufacturer’s instructions. The PCR amplification products were quantified by SYBR-green based qRT-PCR (Takara) following a standard procedure. The mRNA expression levels of target genes were normalized by β-Actin. Primer sequences are provided in Table 1.
Primers Used for qRT-PCR
Gene
Sequence 5′—3′ forward
Sequence 5′—3′ reverse
β-Actin
GTGACGTTGACATCCGTAAAGA
GCCGGACTCATCGTACTCC
Il-6
GCTACCAAACTGGATATAATCAGGA
CCAGGTAGCTATGGTACTCCAGAA
Il-1β
TGTAATGAAAGACGGCACACC
TCTTCTTTGGGTATTGCTTGG
Tnfα
TTCTATGGCCCAGACCCTCA
TTTGCTACGACGTGGGCTAC
Dj-1
GTGCAGTGTAGCCGTGATGT
CCTCCTGGAAGAACCACCAC
Liver tissue or cell samples were processed to Western blotting analysis as we previously described.28 (link) Primary antibodies were rabbit anti-DJ-1 (Abcam, Cambridge, MA), mouse anti-PARKIN (Santa Cruz Technology, Santa Cruz, CA), mouse anti-Ub (Santa Cruz Technology), rabbit anti-LC3B (Proteintech, Wuhan, China), rabbit anti-PHB (Proteintech), rabbit anti-SQSTM1 (Cell Signaling Technology), rabbit anti-ATG5 (Cell Signaling Technology), and anti-β-actin (Sigma-Aldrich).
Xu M., Hang H., Huang M., Li J., Xu D., Jiao J., Wang F., Wu H., Sun X., Gu J., Kong X, & Gao Y. (2021). DJ-1 Deficiency in Hepatocytes Improves Liver Ischemia-Reperfusion Injury by Enhancing Mitophagy. Cellular and Molecular Gastroenterology and Hepatology, 12(2), 567-584.
Liu D., Ge L., Wang Q., Su J., Chen X., Wang C, & Huang K. (2020). Low-level contamination of deoxynivalenol: A threat from environmental toxins to porcine epidemic diarrhea virus infection. Environment International, 143, 105949.
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to
get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required