The largest database of trusted experimental protocols

2 protocols using rabbit anti sqstm1

1

Quantitative RT-PCR and Western Blot Analysis of Liver Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA of liver tissues was isolated with the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Eight hundred nanograms total RNA was reverse-transcribed into cDNA using the PrimeScript RT reagent Kit (Takara, Tokyo, Japan) following the manufacturer’s instructions. The PCR amplification products were quantified by SYBR-green based qRT-PCR (Takara) following a standard procedure. The mRNA expression levels of target genes were normalized by β-Actin. Primer sequences are provided in Table 1.

Primers Used for qRT-PCR

GeneSequence 5′—3′ forwardSequence 5′—3′ reverse
β-ActinGTGACGTTGACATCCGTAAAGAGCCGGACTCATCGTACTCC
Il-6GCTACCAAACTGGATATAATCAGGACCAGGTAGCTATGGTACTCCAGAA
Il-1βTGTAATGAAAGACGGCACACCTCTTCTTTGGGTATTGCTTGG
TnfαTTCTATGGCCCAGACCCTCATTTGCTACGACGTGGGCTAC
Dj-1GTGCAGTGTAGCCGTGATGTCCTCCTGGAAGAACCACCAC
Liver tissue or cell samples were processed to Western blotting analysis as we previously described.28 (link) Primary antibodies were rabbit anti-DJ-1 (Abcam, Cambridge, MA), mouse anti-PARKIN (Santa Cruz Technology, Santa Cruz, CA), mouse anti-Ub (Santa Cruz Technology), rabbit anti-LC3B (Proteintech, Wuhan, China), rabbit anti-PHB (Proteintech), rabbit anti-SQSTM1 (Cell Signaling Technology), rabbit anti-ATG5 (Cell Signaling Technology), and anti-β-actin (Sigma-Aldrich).
+ Open protocol
+ Expand
2

Investigating Molecular Mechanisms of PEDV

Check if the same lab product or an alternative is used in the 5 most similar protocols
Deoxynivalenol (DON, purity ≥ 98%, for experiments in vitro), chloroquine (CQ), rapamycin (Rapa) and rabbit anti-LC3B antibody were purchased from Sigma-Aldrich (St. Louis, USA). Deoxynivalenol (DON, purity ≥ 98%, for experiments in vivo) was purchased from Pribolab (Immunos, Singapore). SB203580 and AUD-S100 were purchased from MedChemExpress (New Jersey, USA). Rabbit anti-SQSTM1, anti-MAPKs, anti-JAK1, anti-pSTING/STING, anti-PI3K, anti-β-actin antibodies and horseradish peroxidase (HRP)-conjugated goat anti-rabbit secondary antibody were purchased from Cell Signaling Technology (Boston, USA). Rabbit anti-claudin1, anti-occludin, anti-ZO-1 and anti-p-MTORC1/MTORC1 antibodies were purchased from Abcam (Cambridge, UK). Porcine epidemic diarrhea virus (PEDV) strain CV777 was obtained from Jiangsu Academy of Agricultural Sciences (Nanjing, China). Rabbit anti-PEDV-N antibody was prepared by our lab. Poly (I:C) (LMW) / LyoVecTM was purchased from InvivoGen (San Diego, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!