Multi gauge software

Manufactured by Fujifilm

Sourced in Japan, United States, France, Germany, United Kingdom, Australia

Multi Gauge software is a comprehensive data analysis and measurement tool developed by Fujifilm. It is designed to provide accurate and reliable measurements of various parameters from a wide range of laboratory equipment and instruments.

Automatically generated - may contain errors

Lab products found in correlation

Las 3000, by Fujifilm (19 mentions) Las 4000, by Fujifilm (16 mentions) Bca protein assay kit, by Thermo Fisher Scientific (14 mentions) Las 4000 mini, by Fujifilm (12 mentions) Complete protease inhibitor cocktail, by Roche (9 mentions) β actin, by Merck Group (8 mentions) Pvdf membrane, by Merck Group (8 mentions) Las 4000 mini system, by Fujifilm (7 mentions) Fluoro image analyzer fla 5000, by Fujifilm (7 mentions) Cell lysis buffer, by Cell Signaling Technology (7 mentions) Trizol reagent, by Thermo Fisher Scientific (6 mentions) Ripa buffer, by Thermo Fisher Scientific (6 mentions) Las 4000 imager, by Fujifilm (6 mentions) Las 4000 mini image analyzer, by Fujifilm (5 mentions) Imagequant las 4000, by GE Healthcare (5 mentions) Las 4000 luminescent image analyzer, by GE Healthcare (5 mentions) Las 3000 image analyzer, by Fujifilm (5 mentions) Protease inhibitor cocktail, by Merck Group (5 mentions) Las 3000 imaging system, by Fujifilm (5 mentions) Pvdf membrane, by Bio-Rad (5 mentions)

Close spelling variants of this product

Multi Gauge software (ver. 2.2; (2 citations) Multi Gauge software version 3.0 (28 citations) Multi Gauge Ver 3.2 imaging software (2 citations) Multi Gauge software V3.0 (23 citations) Image Multi-Gauge Software (8 citations) Multi Gauge-Ver3.X software (2 citations) Multi Gauge software Version 2.3 (4 citations) Multi Gauge Software of Science Lab 2006 (11 citations) Multi Gauge Software (BAS-1000, (2 citations) Multi Gauge image analysis software (11 citations)

420 protocols using multi gauge software

Whole-tissue and micro-autoradiography for atherosclerosis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For whole-tissue autoradiography, the extracted aorta from 3 athero, control and WT mice was placed on an imaging plate (FujiFilm, Tokyo, Japan) for overnight exposure at −80°C. A digital readout of the imaging plate was obtained using a FLA-7000 scanner (FujiFilm, Tokyo, Japan), and images were analyzed with MultiGauge software (FujiFilm, Tokyo, Japan). Optical density corresponding to tracer uptake was quantified in PSL/mm². The entire aorta was excised vertically and subjected to ORO staining (see below).
For micro-autoradiography, the extracted aorta from 2 athero mice was embedded and frozen in optimal cutting temperature (OCT) compound. The frozen tissue samples were cut into 10 μm sections on a cryotome (Leica Microsystems, Bannockburn, IL). Autoradiographic images were obtained by placing tissue sections on an imaging plate (FujiFilm, Tokyo, Japan) for overnight exposure at −80°C. A digital readout was obtained using a FLA-7000 scanner (FujiFilm, Tokyo, Japan), and images were analyzed with MultiGauge software (FujiFilm, Tokyo, Japan). Adjacent sections were used for histologic studies. Digital autoradiographic images were visually co-registered with stained tissue sections and tracer uptake was quantified in regions of interest (ROI) that included the plaque and unaffected vessel wall in PSL/mm2.

Su H., Gorodny N., Gomez L.F., Gangadharmath U.B., Mu F., Chen G., Walsh J.C., Szardenings K., Berman D.S., Kolb H.C, & Tamarappoo B.K. (2014). Atherosclerotic plaque uptake of a novel integrin tracer 18F-Flotegatide in a mouse model of atherosclerosis. Journal of nuclear cardiology : official publication of the American Society of Nuclear Cardiology, 21(3), 553-562.

+ Open protocol

+ Expand

Reconstituted PCNA-Dependent DNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The assay was performed essentially as described in (37 (link)). The reaction (20 μl final volume) was assembled on single primed ФX174 virion ssDNA (5 nM) in buffer O (20 mM Tris–Cl pH 7.5, 5 mM DTT, 0.1 mM EDTA, 70 mM KCl, 0.5 mM ATP, 40 μg/ml BSA, 8 mM MgCl₂, 5% glycerol and 60 μM each of dGTP and dCTP), in the presence of RPA (1 μM), PCNA (10 nM), RFC (17.5 nM), Pol δ (5 nM) followed by a 5 min incubation at 30°C to allow loading of PCNA on the substrate. DNA synthesis was initiated by adding the start buffer (60 μM dTTP and 0.375 μCi [α-32P]dATP in buffer O). After the indicated time at 30°C, the reactions were stopped with SDS (0.5% final) and Proteinase K (0.5 mg/ml) and loaded onto an agarose gel (0.8% (w/v)). After electrophoresis, the gel was dried on DE81 paper, exposed to phosphorimager screen, scanned in Fuji FLA 9000 imager and analyzed with the Multi Gauge software (Fuji).

Shemesh K., Sebesta M., Pacesa M., Sau S., Bronstein A., Parnas O., Liefshitz B., Venclovas Č., Krejci L, & Kupiec M. (2017). A structure–function analysis of the yeast Elg1 protein reveals the importance of PCNA unloading in genome stability maintenance. Nucleic Acids Research, 45(6), 3189-3203.

+ Open protocol

+ Expand

Western Blot Analysis of Protein Extracts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were collected and lysed with lysis buffer (50 mM Tris-HCl, pH 7.5, 1% [vol/vol] Triton X-100, 5% [vol/vol] glycerol, 5 mM EDTA, and 150 mM NaCl). After centrifugation at 18,000 × g for 15 min at 4°C, supernatants were collected. Threefold-concentrated Laemmli’s sample buffer (0.1875 M Tris-HCl, pH 6.8, 15% [vol/vol] β-mercaptoethanol, 6% [wt/vol] SDS 30% [vol/vol] glycerol, and 0.006% [wt/vol] bromophenol blue) was added to the supernatants, and the samples were boiled for 3 min. Proteins were separated by SDS–PAGE and transferred onto a nitrocellulose membrane (Advantec TOYO, Tokyo, Japan). The membrane was blocked with TBST (10 mM Tris-HCl, pH 7.4, 0.1 M NaCl, and 0.1% Tween-20) containing 5% (wt/vol) nonfat skim milk and probed with specific antibodies diluted with TBST containing 5% (wt/vol) nonfat skim milk or 5% (wt/vol) bovine serum albumin (BSA) overnight at 4°C. After probing with HRP-conjugated secondary antibodies, the bound antibodies were detected with Western Lightning Plus-ECL. Image acquisition was performed with an LAS 4000 mini image analyzer (Fujifilm, Tokyo, Japan), and image analysis was done by MultiGauge software (Fujifilm).

Yamamori T., Ike S., Bo T., Sasagawa T., Sakai Y., Suzuki M., Yamamoto K., Nagane M., Yasui H, & Inanami O. (2015). Inhibition of the mitochondrial fission protein dynamin-related protein 1 (Drp1) impairs mitochondrial fission and mitotic catastrophe after x-irradiation. Molecular Biology of the Cell, 26(25), 4607-4617.

+ Open protocol

+ Expand

Phospho-Kinase Array Analysis of Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

We performed a human phospho-kinase array analysis using our four cell lines. The relative phosphorylation levels of 39 selected proteins on the array were acquired by using the Proteome Profiler Human Phospho-Kinase Array Kit (R&D Systems, Minneapolis, MN, USA) according to the manufacturer's instructions. The expression levels of phosphorylation proteins were quantified by the Fuji Film Multi Gauge software (Tokyo, Japan).

Toda-Ishii M., Akaike K., Suehara Y., Mukaihara K., Kubota D., Kohsaka S., Okubo T., Mitani K., Mogushi K., Takagi T., Kaneko K., Yao T, & Saito T. (2016). Clinicopathological effects of protein phosphatase 2, regulatory subunit A, alpha mutations in gastrointestinal stromal tumors. Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc, 29(11).

+ Open protocol

+ Expand

Aptamer Binding Efficiency Determination

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The relative binding efficiency of each aptamer variant to the target protein was determined by EMSA, as described previously [16 (link),17 (link),27 (link)]. The conditions for the binding and gel electrophoresis, along with their respective buffers, are summarized in electronic supplementary material, table S6. The relative binding efficiency of each aptamer variant with the target protein was determined from the shifted band patterns on the gels, detected with a LAS-4000 bioimager (Fuji Film) after staining with SYBR Gold. The band densities of free and complexed DNAs were quantified using the Multigauge software (Fuji Film), and the relative binding (%) was calculated by normalization with the shifted ratio for the original aptamer in the same gel.

Kimoto M., Tan H.P., Tan Y.S., Mislan N.A, & Hirao I. (2023). Success probability of high-affinity DNA aptamer generation by genetic alphabet expansion. Philosophical Transactions of the Royal Society B: Biological Sciences, 378(1871), 20220031.

+ Open protocol

+ Expand

Mutant U2AF1 Splicing Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Inserts containing the ATR genomic locus (Chr 3: 142168271-142172075, deleting the region 142169744-142171669) with a single mutation at −3 position of the 3′ splice site were chemically synthesized by Fasmac (Kanagawa, Japan) and were cloned into pcDNA vector. The coding sequence of human U2AF1 was amplified by PCR using cDNA and was cloned into pcDNA3 vector with mCherry tag. The single mutation for S34F and S34Y of human U2AF1 was generated by PCR. Both minigene and U2AF1 expression plasmid vectors were injected into HEK293 cells, and infected cells were selected and collected by FACSAria II (BD Bioscience). After lysis of cells, spliced minigene was checked by RT-PCR using primers, 5′-AAGCTTCCACCATGGTCTTAAAG-3′ and 5´-GTCGCTGCTCAATGTCAAGA-3′. For quantitative analysis, the gel image was acquired using ImageQuant LAS 4000 (GE Healthcare) and quantified using Multi Gauge software (Fujifilm, Japan). Two replicas were performed for each experiment.

Yoshida H., Park S.Y., Sakashita G., Nariai Y., Kuwasako K., Muto Y., Urano T, & Obayashi E. (2020). Elucidation of the aberrant 3′ splice site selection by cancer-associated mutations on the U2AF1. Nature Communications, 11, 4744.

+ Open protocol

+ Expand

Reconstitution of DNA Synthesis Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The assay was basically performed as described by Langston and O'Donnell (Langston & O'Donnell, 2008). ϕX174 virion circular ssDNA (0.5 nM) primed with a 70‐mer (5′‐CAAAACGGCAGAAGCCTGAATGAGCTTAATAGAGGCCAAAGCGGTCTGGAAACGTACGGATTGTTCAGTA‐3′) was incubated with PCNA (10 nM), RFC (17.5 nM), RPA (75 nM) and Polδ (10 nM) in buffer REP (20 mM Tris–HCl pH 7.5, 1 mM DTT, 12 mM MgCl₂, 50 mM KCl, 0.1 μg/μl BSA, 0.09 μM dCTP, 0.09 μM dGTP, 1.25 mM ATP and an ATP‐regenerating system consisting of 20 mM creatine phosphate and 20 μg/ml creatine kinase) for 5 min at 30°C. Rad51 (300 nM) was added to the indicated reactions and incubated for 5 min at 30°C followed by the addition of various amounts of Srs2. After additional incubation for 10 min at 30°C, the DNA synthesis was initiated by adding start buffer (90 μM dTTP and 0.0375 μCi [α‐³²P]dATP in buffer REP). Following the incubation for 5 min at 30°C, SDS (0.5% final) and proteinase K (0.5 mg/ml) were added and mixture loaded onto an 0.8% agarose gel. After electrophoresis, the gel was dried on GRADE 3 CHR paper (Whatman), exposed to a phosphorimager screen and scanned using a Fuji FLA 9000 imager, followed by analysis with Multi Gauge software (Fuji).

Vasianovich Y., Altmannova V., Kotenko O., Newton M.D., Krejci L, & Makovets S. (2017). Unloading of homologous recombination factors is required for restoring double‐stranded DNA at damage repair loci. The EMBO Journal, 36(2), 213-231.

+ Open protocol

+ Expand

Ribosome Profiling of CTIF-Expressing Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

MEF-eIF2α (A/A) cells were cultured in three 150-mm culture dishes. When indicated, the cells were transiently transfected with plasmid expressing either GST-CTIF-WT or GST-CTIF(54–598). Two days after transfection, cells were washed with 10 ml of ice-cold PBS containing 100 μg ml⁻¹ cycloheximide. After washing, cell extraction was resuspended with 1 ml of lysis buffer (50 mM MOPS, 15 mM MgCl₂, 150 mM NaCl, 100 μg ml⁻¹ cycloheximide, 0.5% Triton X-100, 1 mg ml⁻¹ Heparin, 0.2 U μl⁻¹ RNase inhibitor, 2 mM PMSF and 1 mM benzamidine) and centrifuged. After harvesting, soluble fraction was loaded onto the top of the pre-established sucrose gradient (10 ml of 10∼50%), and centrifuged at 36,000 r.p.m. in a Beckman SW-41 Ti rotor for 2 h at 4 °C. After ultracentrifugation, gradients were fractionated and collected using the ISCO tube piercer (Brandel) and fraction collector (Bio-Rad). Fractions were analysed by western blotting, where the signal intensities of each fraction were quantitated and analysed using the Multi Gauge software (version 3.0, Fujifilm).

Park J., Park Y., Ryu I., Choi M.H., Lee H.J., Oh N., Kim K., Kim K.M., Choe J., Lee C., Baik J.H, & Kim Y.K. (2017). Misfolded polypeptides are selectively recognized and transported toward aggresomes by a CED complex. Nature Communications, 8, 15730.

+ Open protocol

+ Expand

Quantifying Apoptosis via TUNEL Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

The apoptotic cell death was evaluated by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) staining. Cells treated with various concentrations of aqueous BJ extract for 12 hours were permeabilized in 10 mM citrate buffer, pH 6.0. After blocking the nonspecific labeling with PBS mixture containing 2% bovine serum albumin and 0.5% NP-40, cells were incubated in TUNEL reaction solution mixed with 9 mM dUTP, 1 mM digoxigenin-labeled dUTP (Roche, Mannheim, Germany), 2.5 mM cobalt chloride, 100 mM Tris pH 7.6 and 0.3 U/μL terminal deoxynucleotidyl transferase for 1 hour at 37°C in a humidified atmosphere. The sections were washed with PBS and incubated with a 1:200 dilution of horseradish peroxidase-conjugated digoxigenin antibody (Roche). With removal of unbound antibody, cell images were taken by fluorescence or confocal microscope. All colored TUNEL images were converted to black and white by Photoshop software, before being quantitated with Multi Gauge software (version 2.1, FUJIFILM). Sections of positively stained cells containing 50 nuclei were counted. Five slides of each concentration and control sections were recorded and three independent experiments carried out.

Kim S.H., Liu C.Y., Fan P.W., Hsieh C.H., Lin H.Y., Lee M.C, & Fang K. (2016). The aqueous extract of Brucea javanica suppresses cell growth and alleviates tumorigenesis of human lung cancer cells by targeting mutated epidermal growth factor receptor. Drug Design, Development and Therapy, 10, 3599-3609.

+ Open protocol

+ Expand

Western Blot Quantification of Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total proteins were extracted in lysis buffer (150 mM NaCl, 20 Mm Tris-HCl, 2 mM EDTA, 1% Nonidet P-40, 0.1% SDS and inhibitor proteases) on ice for 1 h and then centrifuged for 15 min at 12,000×g and 4 °C. The supernatant containing total protein was recovered, and the protein concentration was evaluated using the Protein Assay Kit (Thermo Fisher Scientific, Strasbourg, France) and quantified by spectrophotometry at 450 nm.
Total protein extract (20 μg) was reduced and size-separated by 8% SDS-PAGE and transferred to PVDF membranes (Bio-Rad, Marnes-la-Coquette, France), which were blocked in 5% BSA (PAA, Les Mureaux, France). Then, the membranes were incubated with specific primary rabbit polyclonal antibodies against ANO1 (ab53213, 1:10; Abcam, Paris, France) and mouse monoclonal β-actin (A5441, 1:500; Sigma, Saint Quentin Fallavier, France). The proteins of interest were detected using ECL detection system (Thermo Fisher Scientific). Relative quantification was performed by densitometric analysis using MultiGauge software (Fujifilm, Courbevoie, France). See Supplementary Fig. 22 for gel source data.

Sonneville F., Ruffin M., Coraux C., Rousselet N., Le Rouzic P., Blouquit-Laye S., Corvol H, & Tabary O. (2017). MicroRNA-9 downregulates the ANO1 chloride channel and contributes to cystic fibrosis lung pathology. Nature Communications, 8, 710.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!