The library preparation for sequencing on RSII system was performed as described before26 (link). For the sequencing on the Sequel platform, about 1.5 µg cDNA was treated with NEBNext End Repair Module (E6050, New England Biolabs) at room temperature for 5 min, followed by purification with Monarch PCR & DNA Cleanup Kit (T1030, New England Biolabs). The end-repaired cDNA was ligated with 2 µL barcoded adaptor (100-466-000, Pacific Biosciences) with T4 DNA Ligase (M0202, New England Biolabs) in 50 µL reaction volume at room temperature for 1 h, followed by purification with Monarch PCR & DNA Cleanup Kit (T1030, New England Biolabs). The un-ligated adaptor and cDNA were digested with E. coli Exonuclease III (M0206, New England Biolabs) and Exonuclease VII (M0379, New England Biolabs) in 1X standard Taq buffer at 37 °C for 1 h, followed by cleaning up with Monarch PCR & DNA Cleanup Kit (T1030, New England Biolabs). The ligated DNA was repaired with PreCR Repair Mix (M0309, New England Biolabs) at 37 °C for 30 min. The libraries were purified with 0.6X volume of AMPure PB beads (100-265-900, Pacific Biosciences) and pooled for sequencing runs. SMRT Link was used to generate the protocol for primer annealing, polymerase binding [Sequel Binding Kit 3.0 (101-613-900, Pacific Biosciences)], cleanup and final loading to SMRT Cells LR and sequencing using Sequel system.
Monarch pcr dna cleanup kit
Manufactured by New England Biolabs
Sourced in United States, Japan, Germany, Australia
The Monarch PCR & DNA Cleanup Kit is a laboratory product designed to purify DNA fragments from PCR reactions or other enzymatic reactions. It allows for the removal of unwanted primers, nucleotides, salts, and other contaminants from DNA samples, preparing them for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Monarch plasmid miniprep kit, by New England Biolabs (7 mentions)
T4 dna ligase, by New England Biolabs (6 mentions)
Q5 dna polymerase, by New England Biolabs (5 mentions)
Monarch rna cleanup kit, by New England Biolabs (5 mentions)
Hiscribe t7 high yield rna synthesis kit, by New England Biolabs (5 mentions)
Monarch dna gel extraction kit, by New England Biolabs (5 mentions)
Megashortscript t7 transcription kit, by Thermo Fisher Scientific (4 mentions)
Pgem t easy vector, by Promega (4 mentions)
Q5 hot start high fidelity dna polymerase, by New England Biolabs (4 mentions)
Qiaquick gel extraction kit, by Qiagen (4 mentions)
Monarch genomic dna purification kit, by New England Biolabs (4 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (4 mentions)
Nextera xt dna library preparation kit, by Illumina (3 mentions)
Dneasy blood and tissue kit, by Qiagen (3 mentions)
Sanger sequencing, by Eurofins (3 mentions)
Qiaprep spin miniprep kit, by Qiagen (3 mentions)
Quickextract dna extraction solution, by Biosearch Technologies (3 mentions)
Microelute genomic dna kit, by Omega Bio-Tek (3 mentions)
Bamhi hf, by New England Biolabs (3 mentions)
Thermo scientific nanodrop, by Thermo Fisher Scientific (2 mentions)
151 protocols using monarch pcr dna cleanup kit
1
Sequel cDNA Library Preparation
2
Phi29 DNA Amplification and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Approximately 10.6-μl DNA and a 5-μl 100-μM 5'end block with a C18 spacer random primer were denaturalized at 95°C for 5 min. Approximately, a 2-μl 10 × Phi29DNA polymerase buffer, 0.4-μl BSA, 1-μl 10-mM DNTP, and 10-U Phi29DNA polymerase were added to each sample, and then incubated under 28°C for 15 h. The sample was purified using the Monarch PCR & DNA cleanup kit (NEB T1030S). A volume of 10.6-μl purified DNA, and a 5-μl 100-μM random primer were used, and the first round of reaction repeated at an incubation temperature of 30°C for 6 h. The Equalbit 1 × dsDNA HS Assay Kit (Vazyme EQ121-011) was used to qualify DNA concentration. Approximately, 10-U S1 Nuclease (Takara 2410A) for 1-ug double-strand DNA was added to the DNA to remove hyper-branched parts of DNA. After digestion at 23°C for 20 min, the sample was purified using the Monarch PCR & DNA cleanup kit (NEB T1030S).
3
Synthetic RNA Standard for CHIKV RT-qPCR Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A house-made synthetic standard RNA was used for the evaluation process of Duo CHIKV RT-qPCR assay, targeting one of the monoplex RT-qPCR included in the Duo assay. The target region, included in a plasmid synthetized by Genscript (GenScript, Piscataway, NJ, USA), was amplified by PCR. A first purification was performed using Monarch PCR & DNA Cleanup Kit (New England BioLabs, Ipswich, MA, USA). The RNA transcript was synthetized in vitro by using MEGAshortscriptTM T7 Transcription Kit (Invitrogen-Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. TURBO DNase included in the same kit was used to remove any residual DNA. The RNA transcript was purified using Monarch PCR & DNA Cleanup Kit (New England BioLabs, Ipswich, MA, USA). The RNA concentration was determined using a Thermo ScientificTM NanoDropTM (Thermo Fisher Scientific, Waltham, MA, USA). The RNA transcript was serially diluted from 108 to 102 copies/µL, and dilutions were stored at −80 °C.
4
Constructing AtTCTP1-Driven Mb3Cas12a System
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ORF containing NLS‐Mb3Cas12a‐3xHA was subcloned from 35‐pcDNA3‐huMb3Cpf1 (a gift from Feng Zhang) into the pKI1.1R backbone by GenScript, creating Mb3Cas12a‐pKI1.1R. To construct pAtTCTP1‐Mb3Cas12a‐pKI1.1R, 1 μg of Mb3Cas12a‐pKI1.1R was doubly digested using 50 units of Apa I (New England Biolabs) and 2 units of Eco RI‐HF (New England Biolabs). The native 0.3‐kb AtTCTP1 promoter and CaMV poly(A) signal cassette was synthesized as a single FragmentGENE DNA fragment (Genewiz), doubly digested with Apa I and Eco RI and ligated to the Mb3Cas12a‐pKI1.1R using 3000 units of T7 DNA Ligase (New England Biolabs). crRNA arrays were cloned by amplifying synthesized FragmentGENE or PriorityGene (Genewiz) fragments with primers crRNA F (5′ GTAGTCGTAGTCGGTCTC 3′) and crRNA R (5′ GGACTCCGTGGATACAAA 3′) using Q5 DNA Polymerase (New England Biolabs). The resulting amplicons were cleaned using a Monarch PCR & DNA Cleanup Kit (New England Biolabs). Approximately 300 ng of cleaned PCR product were digested with 12 units of BsaI‐HFv2 (New England Biolabs), gel purified using a Monarch PCR & DNA Cleanup Kit and inserted into Aar I‐digested Mb3Cas12a‐pKI1.1R with T7 DNA Ligase (New England Biolabs), and transformed into DH10B cells using electroporation. All clones were sequence verified using Sanger sequencing.
5
In-house Synthetic RNA Standard for Trio TOSV RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An in-house synthetic standard RNA was used for the evaluation process of the Trio TOSV RT-qPCR assay, containing the three regions targeted by the three monoplex RT-qPCR assays included in the Trio assay. The standard RNA sequence is available in the Supplementary File . The three target regions, included in a plasmid synthesized by Genscript (GenScript, Piscataway, NJ, USA), were amplified by PCR. A first purification was performed using a Monarch PCR & DNA Cleanup Kit (New England BioLabs, Ipswich, MA, USA). The RNA transcript was synthetized in vitro by using a MEGAshortscriptTM T7 Transcription Kit (Invitrogen—Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. TURBO DNase included in the same kit was used to remove any residual DNA. The RNA transcript was purified using a Monarch PCR & DNA Cleanup Kit (New England BioLabs, Ipswich, MA, USA). The RNA concentration was determined using a Thermo ScientificTM NanoDropTM (Thermo Fisher Scientific, Waltham, MA, USA). The RNA transcript was serially diluted from 6 × 105 to 102 copies/mL, and dilutions were stored at −80 °C.
6
Guinea Pig Intronic and Exonic Sequence Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To obtain the missing guinea pig Aire intron 3 sequence, DNA was extracted from guinea pig liver using ethanol precipitation. PCR on the region of interest was performed using Phusion High-Fidelity PCR Master Mix with HF buffer (Thermo Fisher Scientific, F531S) and primers with sequences: forward AAGACTCCTGTACTGCCACC and reverse GCTGCAACTCCGAATTACCC. A single PCR product was confirmed by gel electrophoresis, purified by a Monarch PCR & DNA Cleanup Kit (NEB, T1030L) and sequenced by Sanger sequencing.
To confirm guinea pig Dnmt3l oocyte expression, RNA extracted from oocytes was treated with TURBO DNase (Thermo Fisher Scientific, AM2238), reverse transcribed with SuperScript III Reverse Transcriptase (Thermo Fisher Scientific, 18080093) and amplified by PCR using AMPIGENE Taq Mix (Enzo, ENZ-NUC100-0200) with primers-specific exons 8 + 10 (forward AGAGCTGATGAGTTTGGGCT, reverse GCCGTACACCAGGTCAAATG) of the annotated guinea pig Dnmt3l transcript ENSCPOT00000004115.3. PCR product was purified by a Monarch PCR & DNA Cleanup Kit (NEB, T1030L) and sequenced by Sanger sequencing.
To confirm guinea pig Dnmt3l oocyte expression, RNA extracted from oocytes was treated with TURBO DNase (Thermo Fisher Scientific, AM2238), reverse transcribed with SuperScript III Reverse Transcriptase (Thermo Fisher Scientific, 18080093) and amplified by PCR using AMPIGENE Taq Mix (Enzo, ENZ-NUC100-0200) with primers-specific exons 8 + 10 (forward AGAGCTGATGAGTTTGGGCT, reverse GCCGTACACCAGGTCAAATG) of the annotated guinea pig Dnmt3l transcript ENSCPOT00000004115.3. PCR product was purified by a Monarch PCR & DNA Cleanup Kit (NEB, T1030L) and sequenced by Sanger sequencing.
7
Targeted Amplicon Sequencing of Zebrafish Embryos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Amplicons for targeted sequencing were generated in two PCR steps. In the first step (PCR1), regions containing the target sites were amplified from 1 μl of the zebrafish embryo lysate, using touchdown PCR with Phusion High-Fidelity Polymerase (NEB, no. M0530S) and primers containing partial sequencing adapters (Supplementary Table 6 ). For some samples, the products of PCR1 were purified using the Monarch PCR & DNA Cleanup Kit (New England Biolabs, no. T1030L) and deep sequenced at the MGH DNA Core. For the rest of the samples, the products of PCR1 were diluted 200-fold with water and used in the second PCR step (PCR2), where Illumina barcodes and P5/P7 sequences were attached to PCR1 products. The PCR2 product yield was assessed by agarose gel electrophoresis and pooled together in equal amounts. The PCR2 product pools were subjected to three steps of purification with the Monarch PCR & DNA Cleanup Kit (New England Biolabs, no. T1030L), Gel DNA Recover Kit (Zymoclean, no.11-300C), and paramagnetic beads (1:1 beads/sample) using the same purification protocol as with AMPure XP beads (Beckman Coulter, no. B37419AB). The product purity was assessed via capillary electrophoresis on a QIAxcel instrument (Qiagen) and quantified by spectrophotometry (NanoDrop®). The resulting sequencing libraries were sequenced using the MiSeq system (Illumina v.2 kit, 2 × 150 bp).
8
Sequencing Library Construction from Transfected Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For both K562 cells and HEK293 cells, we harvested cells 24 hours after transfection, extracted total mRNA, and performed reverse transcription using the Superscript IV Reverse Transcriptase kit (Invitrogen 18090010). A sequencing library was then constructed using a nested PCR strategy. Briefly, we first used Q5 (New England BioLabs M0515) polymerase to amplify the region containing the cBC-rBC barcodes with SCARED P17 and SCARED P18. The total reaction volume was 50μl with 50ng of backbone and 2.5 μl of 10uM primer each. After 25 cycles of amplification the product was purified with the Monarch PCR&DNA Cleanup kit (New England BioLabs T1030L) and eluted with 20 μl of ddH2O. Sequencing adapters were then added with 2 rounds of PCR, 10 cycles each. 0.25μl of PCR product was used with SCARED P19 and P20, then purified using the Monarch PCR&DNA Cleanup kit (New England BioLabs T1030L). Finally, we used 2 μl of this product with primers SCARED P5 and SCARED P7, and then sequenced the resulting product on an Illumina Mi-seq instrument. The activity of library members was computed as described previously 21 .
9
Poly(A)+ RNA Extraction and 3' Extension
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Poly(A)+-RNA from BT20 cells was purified using 5′-biotin-linked oligo-dT25 and Dynabeads MyOne Streptavidin C1 (Invitrogen). A total of 10 ng poly(A)+-RNA was reverse transcribed with RT primers by M-MuLV Reverse Transcriptase (NEB) and PCR amplified by Pfu Polymerase (Promega) as described in detail in Supplemental Figure S2 . PCR products were purified by Monarch PCR & DNA Cleanup Kit (NEB) and sequenced to confirm 3′ end extension.
A list of RT and PCR primers is presented inSupplemental Table S1 .
A list of RT and PCR primers is presented in
10
RNA Extraction and Probe Synthesis for Lice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 5-day-old female lice with TRI reagent (MRC, Cincinnati, OH, USA) and treated with DNase I (Takara Biotechnology, Shiga, Japan) according to the manufacturer’s protocol. First-strand cDNA was synthesized using SuperScript IV reverse transcriptase (Invitrogen, Carlsbad, CA, USA).
For probe synthesis, LNSP1, LNSP2 and TG fragments were amplified from the female cDNA (primer sequences are shown in Additional file 1: Table S1). For LNSP1 and LNSP2 that show high sequence similarities, respective probe was designed from gene-specific sites in the N terminal domains. The PCR products were cloned into pGEM-T easy vector (Promega, Madison, WI, USA). Each plasmids were digested by ApaI (New England Biolabs, Ipswich, MA, USA) for sense probe (negative control) or NdeI (New England Biolabs) for antisense probe at 37°C for 1 h. The plasmids were checked by electrophoresis to confirm digestion and purified using Monarch® PCR & DNA Cleanup Kit (New England Biolabs). Sense or antisense LNSP1, LNSP2 and TG probes were generated using T7 or SP6 RNA polymerase (Promega). FITC RNA labeling mix or DIG RNA labeling mix (both from Roche, Mannheim, Germany) were used for LNSP1/LNSP2 probe or TG probes, respectively.
For probe synthesis, LNSP1, LNSP2 and TG fragments were amplified from the female cDNA (primer sequences are shown in Additional file 1: Table S1). For LNSP1 and LNSP2 that show high sequence similarities, respective probe was designed from gene-specific sites in the N terminal domains. The PCR products were cloned into pGEM-T easy vector (Promega, Madison, WI, USA). Each plasmids were digested by ApaI (New England Biolabs, Ipswich, MA, USA) for sense probe (negative control) or NdeI (New England Biolabs) for antisense probe at 37°C for 1 h. The plasmids were checked by electrophoresis to confirm digestion and purified using Monarch® PCR & DNA Cleanup Kit (New England Biolabs). Sense or antisense LNSP1, LNSP2 and TG probes were generated using T7 or SP6 RNA polymerase (Promega). FITC RNA labeling mix or DIG RNA labeling mix (both from Roche, Mannheim, Germany) were used for LNSP1/LNSP2 probe or TG probes, respectively.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!