Short hairpin RNAs (shRNAs) stably knocked out circ_0062020 (sh-circ_0062020), small interfering RNAs (siRNAs) specifically inhibited circ_0062020 (si-circ_0062020) expression, miR-615-5p inhibition (miR-615-5p inhibitor), miR-615-5p overexpression (miR-615-5p mimic), TRIP13 overexpression (pc-TRIP13), and the corresponding negative controls (sh-NC, si-NC, inhibitor NC, miRNA NC, pc-NC) were synthesized and provided by GenePharma (Shanghai, China). The transfection was performed by Lipofectamine2000 (Invitrogen) to DU145 and LNCaP cells according to the manufacturer’s protocol.
Mir 615 5p mimic
Manufactured by GenePharma
Sourced in China
The MiR-615-5p mimic is a synthetic double-stranded RNA molecule designed to mimic the endogenous microRNA MiR-615-5p. This product can be used for in vitro studies to investigate the biological functions and target gene regulation of MiR-615-5p.
Automatically generated - may contain errors
Lab products found in correlation
Mirna nc, by GenePharma (1 mentions)
Pc nc, by GenePharma (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Si nc, by GenePharma (1 mentions)
Sh nc, by GenePharma (1 mentions)
Inhibitor nc, by GenePharma (1 mentions)
Dual luciferase reporter assay system, by Promega (1 mentions)
Mir 567 mimic, by GenePharma (1 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (1 mentions)
Mir 515 5p mimic, by GenePharma (1 mentions)
Mir 558 mimics, by GenePharma (1 mentions)
Mir nc, by GenePharma (1 mentions)
Sifn1, by GenePharma (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Plo cir vector, by Geneseed (1 mentions)
4 protocols using mir 615 5p mimic
1
Targeting circ_0062020 in Prostate Cancer
2
Luciferase Assay for circSPECC1 and HIP1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
circSPECC1 and huntingtin-interacting protein-1 (HIP1) wild-type (WT) and mutant sequences, with or without the miR-615-5p binding site, were cloned and inserted into pGL3 luciferase plasmids. Each recombined plasmid (1.5 μg) was cotransfected into HEK293 cells with a miR-615-5p mimic (100 nM; GenePharma) and a pRL-TK plasmid (10 ng). Twenty-four hours after transfection, the cells were collected and lysed. Luciferase activities were evaluated using a dual-luciferase reporter assay system (Promega, Madison, USA). The intensities of the firefly and Renilla luciferases were recorded and measured.
3
Overexpression and Silencing of Circular RNA in Lung Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The hsa_circ_0030998‐overexpressing plasmid and the corresponding vector were successfully constructed by Nanjing Dehengwen Biological Technology Co., Ltd. (Nanjing, China). The sequences of circ_0030998 siRNAs were designed, and the target sequences were circ_0030998 siRNA1: 5’‐AGCTCCAAAGAACATGACCTT‐3’; and circ_0030998 siRNA2: 5’‐GAGCTCCAAAGAACATGACCT‐3’. circ_0030998 siRNAs, MMP1 siRNAs, MMP17 siRNAs, negative control (NC), miR‐1236 mimics, miR‐556‐5p mimics, miR‐558 mimics, miR‐567 mimics, miR‐574‐5p mimics, miR‐515‐5p mimics, miR‐615‐5p mimics, and miR‐NC were synthesized by GenePharma (Shanghai, China). A549 and H1299 cells were evenly seeded into 6‐well plates at a density of 1 × 105 cells/well. After incubation for 8 h, cells were transfected with the specified plasmids, miRNA mimics, and siRNAs by applying Lipofectamine 3000 Reagent (Invitrogen, Waltham, MA, USA) in line with the experimental instructions. The detailed cell phenotype assays, including CCK‐8, colony formation, EdU staining, wound healing, and Transwell assays, are described in the Supporting Information.
4
Modulation of circ-CAMK2A and miR-615-5p in LUAD
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small interfering RNA targeting circ-CAMK2A (si-circ-CAMK2A) or fibronectin 1 (si-FN1), miR-615-5p mimics and inhibitors were all purchased from Gene-Pharma (Shanghai, China). The above oligonucleotides including 50 nM si-circ-CAMK2A (5′-AAACCTGCGGAAACAGGAAAT-3′), miR-615-5p mimics (sense: 5′-GGGGGUCCCCGGUGCUCGGAUC-3′; anti-sense: 5′-UCCGAGCACCGGGGACCCCCUU-3′) or inhibitors (5′-GATCCGAGCACCGGGGACCCCC-3′) and 1 μg of circ-CAMK2A-overexpressing pLO-ciR vector (Geneseed, Guangzhou, China) vectors were alone or in combination transfected into A549 and HCC827 LUAD cell lines with a 60–70% confluence using Lipofectamine 3000 (Invitrogen, Waltham, MA, USA). After 48 h of transfection, cells were collected for detection of transfection efficiency and subsequent experiments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!