The anti-TEX12 (ab122455), anti-pericentrin (ab28144), anti-gamma tubulin (ab191114), anti-centrin 1 and 2 (ab11257) and anti-SYCE2 (ab107745) antibodies were obtained from Abcam and anti-FLAG (F1804) antibody was purchased from Sigma. Human TEX12 sequences, corresponding to amino acids 1–123 (full length) and 49–123 (core) and 45–123, 1–113, 1–91, 1–56 and 87–123, and SYCE2 were cloned into the pCMV-HA vector (Addgene Catalogue no 631604) for mammalian expression with an N-terminal FLAG-tag.
Anti flag antibody f1804
Manufactured by Merck Group
Sourced in United States
The Anti-FLAG antibody (F1804) is a laboratory reagent used for the detection and purification of proteins tagged with the FLAG peptide sequence. The antibody specifically binds to the FLAG epitope, which is a widely used tag for recombinant protein expression and purification. This antibody can be employed in various immunochemical techniques, such as Western blotting, immunoprecipitation, and immunoaffinity chromatography, to facilitate the identification and isolation of FLAG-tagged proteins.
Automatically generated - may contain errors
Lab products found in correlation
Lsm 710 confocal microscope, by Zeiss (3 mentions)
Anti acetylated tubulin sc 23950, by Santa Cruz Biotechnology (2 mentions)
Anti gapdh sc 25778, by Santa Cruz Biotechnology (2 mentions)
Anti gapdh 60004, by Proteintech (2 mentions)
Anti sirt1 sc 15404, by Santa Cruz Biotechnology (2 mentions)
Immobilon western blotting kit, by Merck Group (2 mentions)
Phosphor screen, by GE Healthcare (2 mentions)
Pv3850, by Thermo Fisher Scientific (2 mentions)
Typhoon fla 7000, by GE Healthcare (2 mentions)
Simplyblue safestain, by Thermo Fisher Scientific (2 mentions)
Anti cyclin b1 sc 245, by Santa Cruz Biotechnology (2 mentions)
Anti pkr monoclonal antibody, by Santa Cruz Biotechnology (2 mentions)
Anti p t446 pkr antibody, by Abcam (2 mentions)
Anti cdc27 sc 9972, by Santa Cruz Biotechnology (2 mentions)
Anti cdk1 antibody, by Cell Signaling Technology (2 mentions)
Anti β actin sc 47778, by Santa Cruz Biotechnology (2 mentions)
Pierce protein a g magnetic beads, by Thermo Fisher Scientific (2 mentions)
Ab28144, by Abcam (1 mentions)
Ab11257, by Abcam (1 mentions)
Ab191114, by Abcam (1 mentions)
48 protocols using anti flag antibody f1804
1
Antibody-Mediated Analysis of TEX12 and SYCE2
2
Cell Line Cultivation and Antibody Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cell line Hep-2, normal bronchial epithelium cell line 16HBE and embryonic kidney cell HEK293T were obtained from CCTCC, China Center for Type Culture Collection. The cell line KB-3-1 was provided by Dr. Zhesheng Chen (St. John’s university, USA). The cells were cultured at an moist atmosphere of 37 °C with 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM) containing 100 unit/ml penicillin, 10% fetal bovine serum (FBS), and 100 ng/ml streptomycin. Anti-E2F1 (3472) and anti-Survivin (2808) antibodies were obtained from Cell Signaling Technology. Anti-Ki-67 (2724-1) antibody was purchased from Abcam. Anti-Cyclin E (51-1459GR) antibody was from BD Pharmingen. Anti-Flag (F1804) antibody and anti-Flag (A2220) Affinity Gel were from Sigma-Aldrich. Anti-GAPDH (KM9002) antibody was from Tianjin Sungene Biotech. Anti-E2F1 (RLT1442) and anti-α-Tubulin (4777) antibodies were from Ruiying Biological.
3
Comprehensive Protein Extraction and Analysis
4
Immunoblotting Antibodies for Epigenetics
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Anti-H3K9me2 (ab1220) and H3K4me2 (ab7766) antibodies were purchased from Abcam (Cambridge, UK); anti-E-cadherin (sc-7870) ACTB(sc-47778) and HRP-conjugated secondary (sc-2031, sc-2004) antibodies were purchased from Santa Cruz Biotechnology (Texas, USA). Anti-FLAG (F1804) antibody was obtained from Sigma-Aldrich (St Louis, USA).
5
Antibody Panel for Acetylation Analysis
6
Studying YY1, SET7/9, and LSD1 Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNA specifically targeting YY1 (GACGACGACTACATTGAACAA), SET7/9 (TAGGGCCAGGGTATTATTATA) or LSD1/AOF2 (CTGGAAATGACTATGATTTAA) was purchased from Qiagen. Anti-YY1 K173me1 and anti-YY1 K411me1 antibodies were generated by GenScript, Inc. Antigen (peptide sequence) used for generating anti-YY1 K173me1 and anti-YY1 K411me1 was CSGGGRVK(me1)KGGGKKS and CKSHILTHAKAK(me1)NNQ, respectively; anti-Flag (F1804) antibody was purchased from Sigma; anti-SET7/9 (07–314) was purchased from Upstate; anti-LSD1/AOF2 (A300-215A) was purchased from Bethyl Laboratory, Inc; anti-YY1(H-10) (SC-7341) and anti-GAPDH (SC-25778) was purchased from Santa Cruz Biotechnology. Flag peptide (F-4799) was purchased from Sigma; YY1K173me1 and YY1K411me1 peptides shared the same sequence as the ones used for antibody production.
7
Biochemical Characterization of HIF-1α Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Anti-Myc (9E10), anti-His (H-15), anti-GAPDH (0411) and anti-HIF-1α (H206) antibodies were purchased from Santa Cruz. Anti-hemagglutinin (anti-HA) antibody was purchased from Covance. Anti-flag (F1804) antibody was purchased from Sigma. Anti-α-tubulin (EPR1333) and anti-Set7 (EPR5574) antibodies were purchased from Epitomics. Anti-HIF-1α (NB100–105) was purchased from Novus Biologicals. Anti-SOD2 (EPR2560Y) antibody was purchased from GeneTex. Anti-PAI-1 (612025) antibody was purchased from BD Transduction Laboratories. Anti-Histone H3 [(D1H2)XP] antibody was purchased from Cell Signaling. Anti-HIF-1α(CH3)-K32 polyclonal antibody was obtained at Abmart with the HIF-1α-K32-me1 peptide (Shanghai, China). The active Set7 protein (14–469) was purchased from Millipore, and S-adenosylmethionine (SAM) (B903S) was purchased from New England Biolabs (NEB). 2ME2 (S1233) was purchased from Selleck, and (R)-PFI-2 was obtained from Tocris. Glucose assay kit was purchased from BioVision, and adenosine triphosphate (ATP) assay kit from Beyotime. 6-[N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl) amino]-2-deoxy-D-glucose(2-NBDG), a glucose analog, was purchased from Invitrogen.
8
Antibody Validation for Protein Analysis
9
Immunoblotting for Protein Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immunoblotting analysis was performed as described previously.[59 ] Anti‐ERα (F‐10) (sc‐8002) was purchased from Santa Cruz Biotechnology; anti‐Flag (F1804) antibody was purchased from Sigma; anti‐CA12 (15180‐1‐AP) antibody was purchased from Proteintech; anti‐β‐actin (66009‐1‐IG) antibody was purchased from Proteintech.
10
Targeted siRNA knockdown of epigenetic regulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNA specifically targeting YY2 (
5′-CAGCTGGCAGAATTTACTAAA-3′), SET7/9 (5′-
TAGGGCCAGGGTATTATTATA-3′) or LSD1/AOF2 (3′-
CTGGAAATGACTATGATTTAA) was purchased from Qiagen (Valencia, CA, USA). Anti-YY2K247me1 and anti-YY2K247pan antibodies were generated by GenScript, Inc (Piscataway, NJ, USA). Antigen (peptide sequence) used for generating anti-YY2K247me1 and anti-YY2 K247pan was CTKVKPKRSK(me1)GEPPK; anti-Flag (F1804) antibody was purchased from Sigma; anti-SET7/9 (07–314) was purchased from Upstate (Billerica, MA, USA); anti-LSD1/AOF2 (A300-215A) was purchased from Bethyl Laboratory Inc. (Montgomery, TX, USA); anti-HA (ab9110) used for ChIP-seq was purchased from Abcam (Cambridge, MA, USA); anti-GAPDH (sc-25778) and anti-ACTIN (SC-8432) were purchased from Santa Cruz Biotechnology (Santa cruz, CA, USA). Peptide sequences were as follows: YY2 K247: CTKVKPKRSKGEPPK; YY2K247me1: CTKVKPKRSK(me1)GEPPK; YY2 K139: TSTQSRSKKPSKKPS.
5′-CAGCTGGCAGAATTTACTAAA-3′), SET7/9 (5′-
TAGGGCCAGGGTATTATTATA-3′) or LSD1/AOF2 (3′-
CTGGAAATGACTATGATTTAA) was purchased from Qiagen (Valencia, CA, USA). Anti-YY2K247me1 and anti-YY2K247pan antibodies were generated by GenScript, Inc (Piscataway, NJ, USA). Antigen (peptide sequence) used for generating anti-YY2K247me1 and anti-YY2 K247pan was CTKVKPKRSK(me1)GEPPK; anti-Flag (F1804) antibody was purchased from Sigma; anti-SET7/9 (07–314) was purchased from Upstate (Billerica, MA, USA); anti-LSD1/AOF2 (A300-215A) was purchased from Bethyl Laboratory Inc. (Montgomery, TX, USA); anti-HA (ab9110) used for ChIP-seq was purchased from Abcam (Cambridge, MA, USA); anti-GAPDH (sc-25778) and anti-ACTIN (SC-8432) were purchased from Santa Cruz Biotechnology (Santa cruz, CA, USA). Peptide sequences were as follows: YY2 K247: CTKVKPKRSKGEPPK; YY2K247me1: CTKVKPKRSK(me1)GEPPK; YY2 K139: TSTQSRSKKPSKKPS.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!