Anti flag antibody f1804
The Anti-FLAG antibody (F1804) is a laboratory reagent used for the detection and purification of proteins tagged with the FLAG peptide sequence. The antibody specifically binds to the FLAG epitope, which is a widely used tag for recombinant protein expression and purification. This antibody can be employed in various immunochemical techniques, such as Western blotting, immunoprecipitation, and immunoaffinity chromatography, to facilitate the identification and isolation of FLAG-tagged proteins.
Lab products found in correlation
48 protocols using anti flag antibody f1804
Antibody-Mediated Analysis of TEX12 and SYCE2
Cell Line Cultivation and Antibody Characterization
Comprehensive Protein Extraction and Analysis
Immunoblotting Antibodies for Epigenetics
Antibody Panel for Acetylation Analysis
Studying YY1, SET7/9, and LSD1 Methylation
Biochemical Characterization of HIF-1α Regulation
Antibody Validation for Protein Analysis
Immunoblotting for Protein Analysis
Targeted siRNA knockdown of epigenetic regulators
5′-CAGCTGGCAGAATTTACTAAA-3′), SET7/9 (5′-
TAGGGCCAGGGTATTATTATA-3′) or LSD1/AOF2 (3′-
CTGGAAATGACTATGATTTAA) was purchased from Qiagen (Valencia, CA, USA). Anti-YY2K247me1 and anti-YY2K247pan antibodies were generated by GenScript, Inc (Piscataway, NJ, USA). Antigen (peptide sequence) used for generating anti-YY2K247me1 and anti-YY2 K247pan was CTKVKPKRSK(me1)GEPPK; anti-Flag (F1804) antibody was purchased from Sigma; anti-SET7/9 (07–314) was purchased from Upstate (Billerica, MA, USA); anti-LSD1/AOF2 (A300-215A) was purchased from Bethyl Laboratory Inc. (Montgomery, TX, USA); anti-HA (ab9110) used for ChIP-seq was purchased from Abcam (Cambridge, MA, USA); anti-GAPDH (sc-25778) and anti-ACTIN (SC-8432) were purchased from Santa Cruz Biotechnology (Santa cruz, CA, USA). Peptide sequences were as follows: YY2 K247: CTKVKPKRSKGEPPK; YY2K247me1: CTKVKPKRSK(me1)GEPPK; YY2 K139: TSTQSRSKKPSKKPS.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!