SaOS-2 cell was kept in the laboratory. GKC (20180521) was obtained from Guizhou Wei Kang Zi Fan Pharmaceutical Co. Ltd. (Guiyang, China). Jiegu-Qili tablet was obtained from Hunan Jin Sha Pharmaceutical Co. Ltd. (Changsha, China). Pentobarbital Sodium (6900183) was purchased from Beijing Solarbio Science & Technology Co. Ltd. Penicillin G Sodium (170907) was from Lukang Pharmaceutical Co. Ltd. (Jining, China). ALP (A059-2), Pi (C006-3), and Ca (C004-2) were supplied by Nanjing Jiancheng Biotechnology Co. Ltd. (Nanjing, China). Primers of ALP, COL-I, OTC, Osterix, RUNX2, BMP2, OPN, OPG, RANKL, and GAPDH were obtained from Shanghai Generay Biotech Co. Ltd. (Shanghai, China). Antibodies against RUNX-2 (ab23981), OPG (ab73400), BMP2 (ab14933), RANKL (ab9957), β-catenin (ab6302), Smad4 (ab40759), GAPDH (ab8245), and GSK3β (ab93926) were from Abcam (Cambridge, England). DKK1 (PHC9214), Noggin (PHC1506), antibodies against Smad1/5 (PA5-80036), and p-Smad1/5 (MA5-15124) were obtained from Thermo fisher (American). p-GSK3β (Ser9, 9336S) antibody was got from Cell Signaling Technology (American). All other reagents used in the present study were of analytical grade.
Ab93926
Manufactured by Abcam
Sourced in United States, United Kingdom
Ab93926 is a laboratory instrument designed for cell analysis applications. It is capable of detecting and quantifying various cellular parameters, such as cell count, viability, and proliferation. The product specifications and technical details are available on the Abcam website.
Automatically generated - may contain errors
Lab products found in correlation
Ab131097, by Abcam (8 mentions)
Ab32572, by Abcam (6 mentions)
Ab8245, by Abcam (5 mentions)
Pvdf membrane, by Merck Group (5 mentions)
Ab6302, by Abcam (3 mentions)
Ab32072, by Abcam (3 mentions)
Bca kit, by Thermo Fisher Scientific (3 mentions)
Ab107166, by Abcam (2 mentions)
Ripa lysis buffer, by Merck Group (2 mentions)
Ab68476, by Abcam (2 mentions)
Gapdh, by Abcam (2 mentions)
Gsk 3β, by Abcam (2 mentions)
Ab16051, by Abcam (2 mentions)
Ab75814, by Abcam (2 mentions)
Ab205718, by Abcam (2 mentions)
Ripa lysis buffer, by Beyotime (2 mentions)
Ab75745, by Abcam (2 mentions)
Ripa buffer, by Beyotime (2 mentions)
Ab150084, by Abcam (2 mentions)
Ab150117, by Abcam (2 mentions)
38 protocols using ab93926
1
SaOS-2 Cell Culture and Reagent Characterization
2
Proximity Ligation Assay for Protein Interaction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used Duolink in situ PLA mouse/rabbit (Sigma, DUO92101) to evaluate two proteins interaction (proximity <40 nm), using previously described protocol32 (link). In brief, adult cardiomyocytes were fixed with 4% formaldehyde for 10 min, then permeabilized in 0.1% Triton X-100 for 15 min, and blocking was carried out for 30 min at 37 °C. Subsequently, primary antibodies that recognize the two proteins of interest were incubated overnight at 4 °C [rabbit anti-SERCA2 (Cell Signaling, 4388; 1/200) and mouse anti-GSK3β (Abcam, ab-93926; 1/200)]. Ligation of PLA probes for 30 min, amplification and detection were performed according to manufacturer’s instructions. Detection was carried out by confocal microscopy65 (link). A maximum intensity projection created an output image from Z stack performed at 0.5 μm depth. A total of 6–11 cells were counted in each experiment (n = 3) for quantification. We used ImageJ software (National Institutes of Health) to quantify the dots corresponding to the positive interaction of the two targeted proteins of interest.
3
Western Blot Analysis of Protein Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The proteins were collected using RIPA lysis buffer (Sigma-Aldrich) containing protease inhibitor. Cell lysates were resolved by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and then transferred onto polyvinylidene fluoride membranes (PVDF). After blocking with 5% skimmed milk, the membranes were incubated overnight with primary antibodies against SM22α (ab14106, 1 μg/ml; Abcam), αSMA (ab7817, 0.341 μg/ml; Abcam), α2AR (ab85570, 1 μg/ml; Abcam), p-GSK-3β (ab107166, 1 μg/ml; Abcam), GSK-3β (ab93926, 1:1000; Abcam), MKP-1 (ab138265, 1:1000; Abcam), NRF2 (ab92946, 1:1000; Abcam) and GAPDH (ab8245, 1:1000; Abcam) at 4℃. Then the membranes were washed three times. After that, the membranes were incubated with secondary antibodies for 2 h at room temperature. After being probed with enhanced chemiluminescence (Yeasen Biotechnology), the proteins were visualized using an image analysis system (Tanon, Shanghai, China). The protein intensity was evaluated by ImageJ software.
4
Aβ25-35 Neurotoxicity Pathway Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Aβ25–35 (#A4559), agomelatine (#A1362), luzindole (#L2407), the primary antibodies against phosphotau (Ser396) (#SAB4504557), tau (#SAB4501830), PTEN (#SAB1406331), GAPDH (#SAB2701826), goat antirab-bit IgG (#A3687), and antibody antimouse IgG (#M8770) were purchased from Sigma-Aldrich Co., St Louis, MO, USA. The primary antibodies against phospho-Akt (Ser473) (#4060) and Akt (#4691) were purchased from Cell Signaling Technology, Danvers, MA, USA. The primary antibodies against phospho-GSK3β (Ser9) (Ab131097) and GSK3β (Ab93926) were purchased from Abcam, Cambridge, UK. Cell counting kit-8 (CCK-8) (#E606335-0500) and ROS assay kit (#50101ES01) were obtained from Sango Biotech (Shanghai, China). Cell MDA assay kit (#A003-4) and LDH assay kit (#A020-2) were purchased from Nanjing Jiancheng Bioengineering Institute (China).
5
Western Blot Analysis of Signaling Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The western blot assay was conducted as previously reported (25 (link)). Total protein was isolated from U251 and A172 cell lines with RIPA lysis buffer (Invitrogen) and quantified using the bicinchoninic acid (BCA) method. The proteins were separated by 10% SDS-PAGE. Equal amount of protein was transferred to a PVDF membrane and incubated at 4°C for 24 h with anti-SLIT1 (1:5,000, ab151724, Abcam, United Kingdom), anti-Wnt (1:1,000, ab15251, Abcam), anti-β-catenin (1:5,000, ab19381 Abcam), anti-p-Gsk-3β (1:1,000, ab131097, Abcam), anti-Gsk-3β (1:1,000, ab93926, Abcam), or anti-GAPDH (1:2000, ab8245, Abcam). The membrane was incubated with HRP-conjugated IgG secondary antibody (1:10,000, ab97051, Abcam) at room temperature for 2 h. The protein blots were visualized using the ECL method. GAPDH served as an internal control.
6
Western Blot Analysis of Stem Cell Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The detailed procedure was outlined in the previous study 21 . Briefly, cells were lysed using Lysis Buffer (KeyGEN BioTECH, Nanjing, China). Protein concentration was measured using a BCA Protein Assay Kit (KeyGEN BioTECH). Twenty micrograms of protein extract was separated by 10% SDS/PAGE, then transferred to nitrocellulose membrane (Promega, Madison, WI, USA) and incubated with the primary antibodies against SLC34A2 (cat. no. 21295‐1‐AP), Nanog (cat. no. 14295‐1‐AP), aldehyde dehydrogenase 1 (ALDH1) A1 (cat. no. 15910‐1‐AP), and β‐actin (cat. no. 60008‐1‐Ig) were purchased from Proteintech (Wuhan, Hubei, P.R.C). Primary antibodies against Gsk3β (ab93926), Wnt3a (ab28472) and β‐catenin (ab32572) were purchased from Abcam (Cambridge, MA, USA). The secondary antibodies (cat. no. KGAA35 and cat. no. KGAA37) were horseradish peroxidase‐conjugated and purchased from KeyGEN BioTECH. New Super ECL (cat. no. KGP1127; KeyGEN BioTECH) was used to develop image in Tanon 5200 machine (Tanon, Shanghai, China).
7
Protein Expression Analysis of Wnt/β-Catenin and Hedgehog Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After treatment, whole cell extract was prepared using radioimmunoprecipitation assay (RIPA) containing protease and phosphatase inhibitors according to the manufacturer's protocol. Nuclear and cytosolic extracts were prepared using NE-PER Nuclear and Cytoplasmic Extraction Reagents (Pierce Biotechnology, Rockford, IL, USA). Equal amounts of cell extract were separated by 10% SDS-PAGE, and electro-transferred to polyvinylidene difluoride membranes. After blocked with 7% nonfat milk for 2 hours, the membranes were blotted with primary antibodies at 4°C overnight, incubated for 1 hour with secondary antibody. In this study, antibodies (Ab) against β-catenin (Abcam ab32572), glycogen synthase kinase-3 beta (GSK-3β, Abcam ab93926), DKK-1 (Abcam ab109416), india hedgehog (IHH, Abcam ab52919), sonic hedgehog (SHH, Abcam ab202342), GLI family zinc finger 2 (Gli-2, Santa cruz SC-28674), β-actin (Santa Cruz SC-47778), patch 1 (ptch1, Santa cruz SC-9016), TATA-box binding protein (TBP, Abcam ab197874), and smoothened (Smo, Santa cruz SC-13943) were used. Finally, signals were detected using West Dura Extended Duration Substrate with exposure to X-ray film.
8
Modulating YTHDF2 Expression in Gastric Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
YTHDF2 antibody (Abcam, ab220163), FOXC2 antibody (ab24340), GSK-3β antibody (Abcam, ab93926), and Snail antibody (Abcam, ab229701) were purchased from Abcam. Over-expressed YTHDF2 lentiviral plasmid was purchased from GeneCopoeia. The shYTHDF2 plasmid was commissioned by Shanghai Genechem Co., Ltd. The sequence of shYTHDF2 is as follows: shYTHDF2 # 1 CCGGGCTACTCTGAGGACGATATTCCTCGAGGAATATCG TCCTCAGAGTAGCTTTTTG; shYTHDF2 # 2 CCGGTACTG ATTAAGTCAGGATTAACTCGAGTTAATCCTGACTTAATCA GTATTTTTG. The lentiviral system was used to package YTHDF2 or shYTHDF2 lentiviral particles, and then virally infect the gastric cancer cell lines. The finally established overexpression or knockout YTHDF2 cell line had undergone long-term puromycin screening.
9
Western Blotting for Protein Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Western blotting was performed as previously described30 (link). Primary antibodies included those for HJURP (Abcam, ab100800, USA), KI67 (Abcam, ab16667, USA), CDKN1A (CST, 2947, USA), AKT (CST, 4691, USA), p-AKTT308 (CST, 13038, USA), ERK1/2 (CST, 4695, USA), p-ERK1/2 (CST, 4370, USA), JNK (CST, 9252, USA), p-JNKT183/Y185 (CST, 4668, USA), GSK3β (Abcam, ab93926, USA), p-GSK3βY216 (Abcam, ab75745, USA), p-GSK3βS9 (CST, 9322, USA), β-catenin (CST, 8480, USA), and GAPDH (ABclonal, A19056, China). Other reagents included cycloheximide, MG132, TWS119, and SP600125 (Sigma).
10
Integrin β1 signaling modulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antibodies against the focal adhesion protein Zyxin (ab50391, 1:200), Vinculin (ab129002, 1:200), Phalloidin (ab176759, 1:1000), and the serine-threonine kinase GSK3 (ab93926, 1:4000) were obtained from Abcam. ITGβ1 antibody was obtained from Proteintech (12594-1-AP, 1:100), while anti-γ-Tubulin antibody was obtained from Sigma (T6557, 1:3000). Secondary antibodies for immunostaining (1:500) were from Jackson ImmunoResearch Laboratories, Inc (715166150, 711545152). Secondary antibodies coupled to Infrared Dyes (IRDye 680 (926–68072) and IRDye 800 (926–32213) at 1:3000 (LI-COR) were used for western blots and analyzed with the LI-COR Odyssey system.
Primers for cloning human DN-ITGβ1 into pCS2 c-terFlag were Inte-Forward: GGCGGATCCACCATGAATTTACAACCAATTTTCTG, Inte-Reverse: GGCATCGAT TATCATTAAAAGCTTCCATATCAG. Primers for cloning human ITGβ1-WT into pCS2 Inte-WT- Reverse: GGCATCGATTTTTCCCTCATACTTCGGA. Pools of 3 target-specific ITGβ1 (sc-35674) and control siRNAs (sc-37007) were obtained from Santa Cruz Biotechnology. Xenopus laevis ITGβ1 antisense MO, sequence 5’GTGAATACTGGATAACGGGCCATCT3’, was designed with the help of GeneTools.
Primers for cloning human DN-ITGβ1 into pCS2 c-terFlag were Inte-Forward: GGCGGATCCACCATGAATTTACAACCAATTTTCTG, Inte-Reverse: GGCATCGAT TATCATTAAAAGCTTCCATATCAG. Primers for cloning human ITGβ1-WT into pCS2 Inte-WT- Reverse: GGCATCGATTTTTCCCTCATACTTCGGA. Pools of 3 target-specific ITGβ1 (sc-35674) and control siRNAs (sc-37007) were obtained from Santa Cruz Biotechnology. Xenopus laevis ITGβ1 antisense MO, sequence 5’GTGAATACTGGATAACGGGCCATCT3’, was designed with the help of GeneTools.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!