Real-time PCR was performed using standard methods as described (61 (link)). The first-strand cDNA was generated by reverse transcription with Oligo (dT) primer (Roche). To quantify the mRNA levels using real-time PCR, aliquots of first-stranded cDNA were amplified with gene-specific primers and Power SYBR Green PCR Master Mix (Bio-Rad) using a Step-1 Real-Time PCR System (Applied Biosystems). The PCR reactions contained 1µg of cDNA (except the cDNA for the IP, for which 5% of the cDNA was used for each gene examined), Universal Master Mix (Applied Biosystems), and 10 µM of forward and reverse primers in a final reaction volume of 20 µL. The mRNA level of different samples was calculated by the data analysis software built in with the 7300 Real-Time PCR System. For RIP-real time PCR, cDNA from IP and input was used and IP samples were normalized to Input samples. The Sequences of primers are provided in supplementary methods .
Step 1 real time pcr system
Manufactured by Thermo Fisher Scientific
The Step-1 Real-Time PCR System is a laboratory instrument designed for quantitative real-time polymerase chain reaction (qRT-PCR) analysis. It enables the detection and quantification of target DNA or RNA sequences in real-time during the amplification process.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green pcr supermix, by Bio-Rad (5 mentions)
Oligo dt primer, by Roche (3 mentions)
7300 real time pcr system, by Thermo Fisher Scientific (3 mentions)
Universal master mix, by Thermo Fisher Scientific (3 mentions)
Power sybr green pcr master mix, by Bio-Rad (3 mentions)
Primescripttm rt reagent kit, by Takara Bio (3 mentions)
Gotaq dna polymerase, by Promega (2 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (2 mentions)
8 protocols using step 1 real time pcr system
1
Quantification of mRNA Levels by Real-Time PCR
2
Quantitative mRNA Expression Analysis
3
Quantifying mRNA Levels by Real-Time PCR
4
Real-Time qPCR Quantification of mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR assays were performed using standard methods as previously described39 ,89 (link). The first-strand cDNA was generated by reverse transcription with both oligo dT primer and random primers using PrimeScriptTM RT Reagent Kit (Takara, #RR037A). To quantify the mRNA levels using real-time PCR, aliquots of first-strand cDNA were amplified with gene-specific primers and universal SYBR Green PCR supermix (Bio-Rad, #172-5124) using a Step-1 Real-Time PCR System (Applied Biosystems). The PCR reactions contained 20–40 ng of cDNA and 300 nM of forward and reverse primers in a final reaction volume of 20 μl. The primers used for PCR are listed in Supplementary Data 3 .
5
Quantitative mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-PCR and real-time PCR were performed using standard methods as described 59 , 64 , 73 . The first-strand cDNA was generated by reverse transcription with random primers using Transcriptor First Strand cDNA Synthesis Kit (Roche, #04896866001). Standard RT-PCR was performed using GoTaq DNA polymerase (Promega, #M3005). To quantify the mRNA levels using real-time PCR, aliquots of first-strand cDNA were amplified with gene-specific primers and universal SYBR Green PCR supermix (Bio-Rad, #172-5124) using a Step-1 Real-Time PCR System (Applied Biosystems). The PCR reactions contained 20-40 ng of cDNA (except the cDNA for the IP, for which 5% of the cDNA was used for each gene examined), and 300 nM of forward and reverse primers in a final reaction volume of 20 μl. The sequences of primers used for RT-PCR reactions are as the following:
6
Quantifying mRNA Levels by Real-Time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR were performed using standard methods as previously described [74 , 75 ]. The first-strand cDNA was generated by reverse transcription with both oligo dT primer and random primers using PrimeScriptTM RT Reagent Kit (Takara, #RR037A). To quantify the mRNA levels using real-time PCR, aliquots of first-strand cDNA were amplified with gene-specific primers and universal SYBR Green PCR supermix (Bio-Rad, #172–5124) using a Step-1 Real-Time PCR System (Applied Biosystems). The PCR reactions contained 20–40 ng of cDNA (except the cDNA for the IP, for which 5% of the cDNA was used for each gene examined), and 300 nM of forward and reverse primers in a final reaction volume of 20 μl. The sequences of primers used for PCR:
| Gapdh | Forward: | AATGGGAAGCTTGTCATCAACG |
| Gapdh | Reverse: | GAAGACACCAGTAGACTCCACGACATA |
| Cacna1h | Forward: | CGTGACACTGGGCATGTTC |
| Cacna1h | Reverse: | CCACCATCTTGATAACCATCTCC |
| Ago2 | Forward: | CGTCCTTCCCACTACCACG |
| Ago2 | Reverse: | CCAGAGGTATGGCTTCCTTCA |
| Fxr1 | Forward: | GGCAGAAGATAGACAGCCAGT |
| Fxr1 | Reverse | TTCTCCCAGAGTACGCGGTAG |
7
Real-Time PCR for Quantifying mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was performed using standard methods as previously described14 (link). The first-strand complementary DNA (cDNA) was generated by reverse transcription with Oligo (dT) primer (Roche). To quantify the mRNA levels using real-time PCR, aliquots of first-stranded cDNA were amplified with gene-specific primers and Power SYBR Green PCR Master Mix (Bio-Rad) using a Step-1 Real-Time PCR System (Applied Biosystems). The PCR reactions contained 1 μg of cDNA (except the cDNA for the IP, for which 5% of the cDNA was used for each gene examined), Universal Master Mix (Applied Biosystems), and 10 μM of forward and reverse primers in a final reaction volume of 20 μL. The mRNA level of different samples was calculated by the data analysis software built in with the 7300 Real-Time PCR System. For RIP-real-time PCR, cDNA from IP and input was used and IP samples were normalized to Input samples. The Sequences of primers are provided in Supplementary Methods.
8
Quantifying mRNA Levels by Real-Time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was performed using standard methods as described [20 (link)]. The first-strand cDNA was generated by reverse transcription with Oligo (dT) primer (Roche). To quantify the mRNA levels using real-time PCR, aliquots of first-stranded cDNA were amplified with gene-specific primers and Power SYBR Green PCR Master Mix (Bio-Rad) using a Step-1 Real-Time PCR System (Applied Biosystems). The PCR reactions contained 1 μg of cDNA, Universal Master Mix (Applied Biosystems), and 10μM of forward and reverse primers in a final reaction volume of 20 μL. The data analysis software built-in with the 7300 Real-Time PCR System calculated the mRNA level of different samples. The sequences of primers used for real-time PCR reactions in mouse species are listed in Additional file 4 : Table S1.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!