We obtained total RNA from hippocampal tissue that had been surgically removed from 11 patients with refractory MTLE who underwent epilepsy surgery and had histopathology confirming HS. Among them, nine were also included in the SNP genotyping study. All 11 patients had pre-surgical MRIs with sings of hippocampal sclerosis. In addition, we obtained normal hippocampal tissue from six autopsies of patients who died of non-neurological-related disorders. We extracted total RNA by Trizol® protocol (Life Technologies, Carlsbad, CA, USA), and assessed RNA quality by NanoVue spectrophotometer at 260/280 nm (GE Healthcare, Buckinghamshire, UK). We quantified the transcripts in triplicate using RT-PCR TaqMan® System and ABI 7500 equipment (Applied Biosystems, Foster City, CA, USA). We used a target ABCC2 assay (probe ID: Hs00166123_m1) and human 18S rRNA as an endogenous control. We calculated the relative quantification using fluorescence signals by the comparative threshold cycle method [31 (link)].
Trizol protocol
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany
TRIzol is a reagent that is used for the isolation of total RNA from biological samples. It is a monophasic solution of phenol, guanidine isothiocyanate, and other components that facilitates the denaturation of proteins and the separation of RNA from DNA and other cellular components during the extraction process.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000, by Thermo Fisher Scientific (14 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (6 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (6 mentions)
2100 bioanalyzer, by Agilent Technologies (4 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Superscript 2 kit, by Thermo Fisher Scientific (4 mentions)
Dnase 1, by Thermo Fisher Scientific (3 mentions)
Bioanalyzer, by Agilent Technologies (3 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (3 mentions)
Dnase, by Promega (3 mentions)
Hiseq platform, by Illumina (3 mentions)
Nanodrop, by Agilent Technologies (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Rnalater, by Qiagen (2 mentions)
Superscripttm 3 first strand synthesis system, by Thermo Fisher Scientific (2 mentions)
Automacs cell separator, by Miltenyi Biotec (2 mentions)
Sodiumcitrate containing preparation tubes, by BD (2 mentions)
Amoflo cell sorter, by Beckman Coulter (2 mentions)
Allprep total rna dnakit, by Qiagen (2 mentions)
Genelute mammalian genomic dna miniprep kit, by Merck Group (2 mentions)
131 protocols using trizol protocol
1
Hippocampal Transcripts in Refractory MTLE
2
Quantitative Analysis of Developmental Gene Expression in Mouse Craniofacial Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from microdissected E10.5 faces through a standard Trizol protocol (Life Technologies). cDNA was made using the SuperScript III First-Strand Synthesis Kit for RT-PCR (Life Technologies) using 1 μg RNA/10 μl reaction. Three biological replicates were used for all analyses. For RT-PCR, the following primers were used: 5F: 5′-GAGACGTAAAGCTGCCAACGTTACCCTCCTC-3′; 7R: 5′-CATGGGAGATGAGGTTGAAGTGGGTCAAGC-3′; PGKup: 5′-GCGCCTCCCCTACCCGGTAGAATTGGCCGCG-3′. For real-time PCR, pre-validated probes and primers were used to examine Tfap2a levels targeting exons 2–3 and 6–7 (IDT PrimeTime assay Mm.PT.56a.1580695 and 12995135, Integrated DNA Technologies, Coralville, IA) as well as Fgf8 (TaqMan gene expression assay Mm00438922_m1, Applied Biosystems, San Francisco, CA) and Wnt9b (TaqMan gene expression assay Mm00457102_m1). Gapdh was used as a housekeeping control for all assays (ABI, TaqMan gene expression assay Mm99999915_g1). The TaqMan Gene Expression Master Mix was used and samples were run on a BioRad MyCycler. Each biological replicate was run in duplicate. Quantification was performed by comparison to a standard curve.
3
Sampling and Extraction of Placental Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Women with euploidy pregnancies who attended KK Women’s and Children’s Hospital, Singapore, were recruited.
Chorionic villus samples from subjects at the first or early second trimesters of pregnancy were collected by chronic villus sampling (CVS). Placenta villi samples (fetal side) were collected from third trimester of pregnancy after delivery. All tissue samples were washed with diethylpyrocarbonate (Sigma-Aldrich, USA) treated water. For DNA analysis, tissues were stored at -80°C. For RNA analysis, tissues were incubated with RNAlater (Life Technologies, USA) at 4°C overnight, and then stored at -80°C. Genomic DNA extraction from tissues was performed with QIAamp DNA Mini Kit (QIAGEN GmbH, Germany), according to manufacturer’s instructions. Total RNA was extracted from frozen tissues using TRIZOL protocol (Life Technologies).
Chorionic villus samples from subjects at the first or early second trimesters of pregnancy were collected by chronic villus sampling (CVS). Placenta villi samples (fetal side) were collected from third trimester of pregnancy after delivery. All tissue samples were washed with diethylpyrocarbonate (Sigma-Aldrich, USA) treated water. For DNA analysis, tissues were stored at -80°C. For RNA analysis, tissues were incubated with RNAlater (Life Technologies, USA) at 4°C overnight, and then stored at -80°C. Genomic DNA extraction from tissues was performed with QIAamp DNA Mini Kit (QIAGEN GmbH, Germany), according to manufacturer’s instructions. Total RNA was extracted from frozen tissues using TRIZOL protocol (Life Technologies).
4
p53 Binding to Bip mRNA Segments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
p53-purified protein (see before) was used. In addition to bip FL mRNA, segments +1 to +982, +983 to +1965, +1 to +491, +492 to +982 and +1 to +346 were synthesized as described. All binding reactions were carried out for 15 min at 37 °C in binding buffer containing 50 mM Tris pH 7.5, 150 mM NaCl, 0.02 μg/ml yeast tRNA, 0.2 mg/ml BSA. 120 ng of recombinant p53 protein and a fixed amount (0.01 pmol) of different bip mRNAs were used. After incubation, RNA-protein complexes were pulled-down ON at 4 °C using anti-p53 DO-12 mouse mAb kindly provided by Dr. B. Vojtesek and protein G sepharose Fast Flow (Sigma-Aldrich). The unbound fraction was recovered for later analysis and the bound RNA was released from the beads using proteinase K (Sigma-Aldrich) for 30 min at 55 °C. All RNA fractions were then extracted and purified using the TRIzol protocol (Life Technologies). RT-qPCR was performed using primers for the following segments: FL (+1 to +1965), +1 to +982, +492 to +982; same primers used for qPCR, +983 to +1965; F 5′GTCCCACAGATTGAAGTCACC3′ and R 5′CCTGTACCCTTGTCTTCAGC3′, +1 to +491 and +1 to +346; F 5′CACGCCGTCCTATGTCGC3′ and R 5′TGTTCTCGGGGTTGGAGG3′, +1 to +246; F 5′GGCCGCGTGGAGATCATC3′ and R 5′GGCGGCATCGCCAATCAG3′. The relative binding of each mRNA to proteins was expressed as the ratio of bound to total (bound+free) RNA.
5
RNA Extraction and Sequencing from Hypoxia Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The posterior ends from the chronic hypoxia exposure and field-collected samples were stored in RNAlater in − 80 °C until further analysis. For total RNA extraction, the tissues (n = 3 per treatment and timepoint) were homogenized with the TissueRuptor II, followed by extraction with the Qiagen RNeasy kit (Qiagen: Catalog no 74104). Tissues from the intermittent hypoxia experiments were flash frozen. For all samples, RNA was extracted from the entire homogenized fragment, without regard for potential differences among different tissue types. Total RNA was extracted using the TRIzol protocol (Life Technologies: Cat No. 15596026), followed by the Qiagen RNeasy clean up. Total RNA was quantified and quality-checked with Qubit RNA High Sensitivity (HS) Assay and SYBR Gold Nucleic Acid Gel Stain, respectively. Illumina TruSeq RNA double-stranded libraries were prepared and sequenced at Texas A&M University’s Agrilife Research Center on the Illumina NovaSeq 6000 (College Station, Texas) with paired end- 150 bp quality controlled with Fragment Analyzer through PROSize 2.0.
6
Subcellular Fractionation and Chromatin-Bound RNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Subcellular fractionation was performed as follows. Cells were washed with ice-cold PBS, resuspended in cold lysis buffer with 0.15% NP-40, and the lysate layered on sucrose buffer to isolate nuclei. Glycerol buffer (20 mM Tris, pH 7.9, 75 mM NaCl, 0.5 mM EDTA, 50% glycerol, and 0.85 mM DTT) and nuclei lysis buffer (20 mM Hepes, pH 7.6, 7.5 mM MgCl2, 20 mM EDTA, 0.3 M NaCl, 1 M urea, 1% NP-40, and 1 mM DTT) were used to isolate nucleoplasmic fraction and chromatin-bound RNA fraction. Chromatin-bound RNA was isolated with Trizol protocol (Life Technologies) and further purified with RNAesy mini-kit (QIAGEN) after DNAse digestion (QIAGEN). Ribosomal RNA was removed with RiboMinus Eukaryote Kit (Life Technologies).
Expression of immature CCSER RNA was evaluated by real-time PCR with the following primers:
Expression of immature CCSER RNA was evaluated by real-time PCR with the following primers:
Pre-TMS FW: CAAGTGTTCATCCCCTAACTTTGA
Pre-TMS REV: GAAAAACAGCGGCCAAGTG
Post-TMS FW: GCTACAGCTTCATTGTTGCATC
Post-TMS REV: CAGGGCTTAGGACCTGCTT
GAPDH Intron1 FW: AGACGGGCGGAGAGAAAC
GAPDH Intron1 REV: CGGAGGGAGAGAACAGTGAG
7
Transcriptome Sequencing of Parasitoid Wasp
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In total, we sequenced six transcriptomes for assisting genome annotation and further analysis. Total RNA was isolated from early larvae (3 days after parasitism), later larvae (9 days after parasitism), male pupae, female pupae, male adults, and female adults of C. chilonis using the TRIzol protocol (Life Technologies, USA). RNA sequencing libraries were constructed using the Illumina mRNA-Seq Prep Kit (Illumina, USA). Briefly, oligo (dT) magnetic beads were used to purify poly(A)-containing mRNA molecules. The mRNA was further fragmented and randomly primed during first-strand synthesis by reverse transcription. This procedure was followed by second-strand synthesis with DNA polymerase I to create double-stranded cDNA fragments. The double-stranded cDNA was subjected to end repair by Klenow and T4 DNA polymerases, and A-tailed by Klenow lacking exonuclease activity. We then ligated the cDNA to Illumina Paired-end Sequencing adapters, performed size selection by gel electrophoresis, and then PCR amplification to complete library preparation. The libraries were sequenced using Illumina HiSeq 2000 (101 bp at each end). The RNA-seq reads were either de novo assembled using Trinity (Haas et al., 2013 (link)) or mapped to the C. chilonis genome using HISAT2 (Kim et al., 2015 (link)) with default parameters.
8
Quantifying Plasmodium falciparum SURF Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For surf transcript quantification, 9 oligo pairs corresponding to the 3D7 surf genes available in plasmoDB (version 8) were designed using Primer3 [66 (link)] (S1 Table ). Notably, surf genes 3 and 8 are identical. Whole RNA was purified from synchronized stages (ring stage, directly after sorbitol treatment, trophozoite stage, 20 h after sorbitol treatment, and schizont stage, 30 h after sorbitol treatment) by the Trizol protocol (Life Technologies) and dissolved in pure water. RNAs were then treated with DNAse1 (Fermentas) and cDNA synthesis was done using RevertAid reverse transcriptase (Fermentas) using random hexamer oligos as published earlier [67 ]. As an endogenous control transcript, the plasmodial serine tRNA ligase transcript (PlasmoDB PF3D7_0717700, herein termed "K1") was used. The primer performance of all surf oligos was compared to PF3D7_0717700 oligos in order to permit relative quantification (Fig C in S1 File ).
9
Quantifying Retinal Cytokine Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The levels of IL-6, TNF-α, IFN-γ and caspase-3 obtained from homogenized retina and RPE were assessed using RT-PCR. RNA was extracted from retinas following the TRIzol protocol (Life Technologies) according to the manufacturer’s instructions. Samples were subjected to RT-PCR and normalized to β-actin to verify the efficiency of RNA extraction and for the presence of cytokines. Primers targeting the cytokines were used32 (link). Where ΔΔCt = (Ct Target gene, treated − Ct β-actin, treated) − (Ct Target gene, control − Ct β-actin, control).
All reactions were performed in an ABI StepOne Plus7500 thermocycler (Life Technologies). The parameters for the amplification of pro-inflammatory cytokines were as follows: 95 °C for 2 min, 94 °C for 45 s, 56 °C for 30 s, 72 °C for 30 s for 40 cycles, and 72 °C for 5 min.
All reactions were performed in an ABI StepOne Plus7500 thermocycler (Life Technologies). The parameters for the amplification of pro-inflammatory cytokines were as follows: 95 °C for 2 min, 94 °C for 45 s, 56 °C for 30 s, 72 °C for 30 s for 40 cycles, and 72 °C for 5 min.
10
Quantitative RT-PCR Analysis of Placental mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated from the placenta or cells in accordance with the standard TRIzol protocol (Life Technologies). RNA (1 μg) was used for cDNA synthesis by using the HiScript III RT SuperMix for qPCR (Vazyme, Nanjing, China) in accordance with the manufacturer’s instructions. qPCR procedure was carried out by using ChamQ SYBR qPCR Master Mix kit (Vazyme, Nanjing, China) in accordance with the manufacturer’s instructions. The abundance of mRNA was quantified using the 2 − ΔΔCT method, which was normalized to the expression level of GAPDH and converted to fold changes, qRT-PCR was performed as previously described [26 ].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!