As previously described (5 (link)), TIANGEN reagent (TIANGEN Biotech, Beijing, China) was used to extract total RNA from homogenized tissue or cultured cells, following the manufacturer's instructions. The reaction solution consisted of 2.0 μl of diluted RT-PCR product, a 0.2 μm concentration of each paired primer, and power SYBR Green PCR master mix (Toyobo, Osaka, Japan). The Kv4.2 primer sequence was 5′-TGTCAGGAAGTCATAGAGGCAGCGTG-3′ (forward) and 5′-GGGGTGGTTACTGGAGGTGTTGGAAT-3′ (reverse). The sequence of housekeeping gene cyclophilin D, used as a control to exclude sampling errors, was 5′-GGACGTCTGTCTTCGAGTCC-3′ (forward) and 5′-AACAGACCGTGGAGATTTGG-3′ (reverse). The annealing temperature was set at 58 °C for Kv4.2 and 61 °C for cyclophilin D, with 38 amplification cycles for each product. The absolute mRNA levels in each sample were calculated according to a standard curve set up using serial dilutions of known amounts of specific templates against corresponding cycle threshold (Ct) values. The normalized ratio of Kv4.2 to cyclophilin D in each group was presented. The specificity of the primers was verified by both gel electrophoresis and sequencing of the PCR products.
Power sybr green pcr master mix
Manufactured by Toyobo
Sourced in Japan
Power SYBR Green PCR Master Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) applications. It contains all the necessary components, including SYBR Green I dye, DNA polymerase, and buffer, to perform PCR amplification and detection.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (3 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Taq polymerase, by GeneAll (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Tiangen reagent, by Tiangen Biotech (1 mentions)
Easypure genomic dna kit, by Transgene (1 mentions)
Primescript rt master mix, by Toyobo (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Uniq 10 rna extraction kit, by Sangon (1 mentions)
Moloney murine leukemia virus reverse transcriptase, by Promega (1 mentions)
Mirna isolation kit, by Thermo Fisher Scientific (1 mentions)
All in one mirna qrt pcr detection kit, by GeneCopoeia (1 mentions)
Cfx96 machine, by Bio-Rad (1 mentions)
Fastquant rt kit, by Tiangen Biotech (1 mentions)
Reverse transcription kit, by Toyobo (1 mentions)
Abi prism 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
12 protocols using power sybr green pcr master mix
1
Quantitative RT-PCR Analysis of Kv4.2 Expression
2
Quantification of Organellar Genome Copy Number
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tachyzoites (iPYK1 or iPYK1-Δpyk2 strain) with or without 3 or 5 days’ ATc treatment were forced to egress by needle passage and purified for DNA extraction using the EasyPure genomic DNA kit (Transgen Biotech, Beijing, China). Thirty ng DNA from each sample was subject to qPCR analysis, using primers (listed in Table S1 ) designed to amplify fragments from the apicoplast genome (EF-Tu), mitochondrial genome (CytB), and nuclear genome (UPRT), respectively, as previously described (43 (link)– (link)45 (link)). The qPCR was performed using the Power SYBR green PCR master mix (Toyobo Co., Ltd., Osaka, Japan), and all reactions were performed on the ABI ViiA 7 detection system (Life Technologies, Inc., Rockville, MD, USA). The threshold cycle (CT) values for the nuclear genome amplification were used as a normalization reference to compare apicoplast and mitochondrial genome abundance across samples. The 2ΔΔCT method was used to estimate the changes of apicoplast and mitochondrial genome abundance after ATc treatment. Every sample was independently tested three times, each with two technical replicates.
3
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol (Thermo Fisher), and then 1 μg RNA was reverse transcribed using Prime Script RT Master Mix (Toyobo). Quantitative PCR was performed using the Power SYBR green PCR Master Mix (Toyobo). The amounts of transcript were normalized to those of glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
4
Quantifying Kv2.1 mRNA Levels by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To measure the Kv2.1 mRNA levels, qPCR (quantitative real-time PCR) analysis was performed with the primer sequences forward, 5′-ATTGCCGGGGTCCTGGTGATTG-3′ and reverse, 5′-GCCCTCTTGGTCCATTTCCACTTGTT-3′. To control for sampling errors, qPCR for the housekeeping gene cyclophilin D was performed with the primer sequences forward, 5′-GGCTCTTGAAATGGACCCTTC-3′ and reverse, 5′- CAGCCAATGCTTGATCATATTCTT-3′. The reaction solution contained 2.0 μl of diluted reverse transcription PCR product, 0.2 μM of each paired primer and Power SYBR Green PCR master mix (Toyobo). The annealing temperature was set at 62°C and 40 amplification cycles were used. The absolute mRNA levels in each sample were calculated according to a standard curve determined using serial dilutions of known amounts of specific templates plotted against the corresponding cycle threshold (CT) values. The normalized ratio of the target gene over cyclophilin D in each sample was calculated. The specificity of the primers was verified by both gel electrophoresis and sequencing of the PCR products.
5
RT-PCR and RT-qPCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The prepared cDNAs were used for RT-PCR with Taq polymerase (GeneALL, Seoul, Republic of Korea) and gene-specific primers (Table S3 ). After initial denaturation at 95 °C for 5 min, PCR was performed using a thermocycler (Step One Plus Real-Time PCR System; Applied Biosystems) with 35 amplification cycles (95 °C for 1 min, 50–55 °C for 30 s, and 72 °C for 1 min) and finalized with an additional extension step at 72 °C for 10 min. The PCR products were assessed by 1% agarose gel electrophoresis. RT-qPCR was performed as per the procedures noted by Bustin et al. [14 (link)] using Power SYBR Green PCR Master Mix (Toyobo, Osaka, Japan) with gene-specific primers (Table S3 ). In addition, after initial heat treatment at 95 °C for 2 min, qPCR was performed with 40 cycles of denaturation at 95 °C for 30 s, annealing at 50−55 °C for 30 s, and extension at 72 °C for 30 s. The elongation factor 1 (EF1, Table S3 ) was used as a reference gene to normalize the expression level of each qPCR sample. Further, quantitative analyses were performed using the comparative CT (2−ΔΔCT) method [15 (link)]. All experiments were independently replicated three times.
6
Quantification of HSD11B2 and SP1 mRNA in Placental Syncytiotrophoblasts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the placental syncytiotrophoblasts 24 h after treatment using an UNIQ-10 RNA extraction kit (Sangon Biotech, Shanghai, China). After determination of RNA concentration, mRNA was reverse transcribed to cDNA with oligo (dT) 12–18 primer using Moloney murine leukemia virus reverse transcriptase (Promega) and cDNA was utilized for subsequent measurement of HSD11B2 and SP1 mRNA levels with qRT-PCR using power SYBR green PCR master mix (Toyobo, Osaka, Japan). The annealing temperature was set at 61°C. The absolute mRNA levels in each sample were calculated according to a standard curve set up using serial dilutions of known amounts of specific PCR product templates against corresponding cycle threshold values. To control for sampling errors, qRT-PCR for the housekeeping gene ACTB was performed on each sample. The ratio of the copy numbers of target gene over ACTB in each sample was obtained to normalize the expression of the target gene. The primer sequences for amplifying human HSD11B2, SP1 and ACTB genes are given in Table 1 .
7
miRNA and Gene Expression Q-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For Q-PCR assay of miR-155, miR-155 primers and its control U6 primers and related kits (miRNA isolation kit and miRNA Q-PCR kit) were purchased from Applied Biosystems and used according to the manufacturer’s instruction. The ΔΔCT method was used to normalize data. For Q-PCR assay of genes, primer sequences used in this study are listed in Table S3 in Supplementary Material. Total RNA was extracted from colon tissues or cells as described above, and cDNA was synthesized with Power SYBR Green PCR Master Mix (Toyobo Co.).
8
Quantifying mRNA and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol Reagent (Invitrogen, Carlsbad, CA, USA). For mRNA analysis, 1 μg of total RNA was reverse transcribed using FastQuant RT Kit (TIANGEN, Beijing, China). Next, the real-time PCR was performed using Power SYBR Green PCR master mix (Toyobo, Osaka, Japan), and data were normalized to β-actin expression. The All-in-One™ miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD, USA) was used to quantitatively measure miRNAs, according to the manufacturer’s protocol, and the relative amount of miRNAs was normalized against U6. All these experiments in triplicate were performed on a Bio-Rad CFX96 machine (Bio-Rad, Hercules, CA, USA), and the fold changes for both miRNA and mRNA were calculated by 2−△△CT method. The primers for miRNA were purchased from Fulengen (Guangzhou, China). The primer sequences used for mRNA detection are listed as follows: IRS1 forward: ACTGGACATCACAGCAGAATGA; and IRS1 reverse: AGAACGTGCAGTTCAGTCAA. FOXO3a forward TGGTTTGAACGTGGGGAACT; and FOXO3a reverse: CAGTTTGAGGGTCTGCTTTGC.
9
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from tissues or cells using Trizol reagent (Invitrogen). The first strand of cDNA was obtained using RNA as template with reverse transcription kits (TOYOBO). Quantitative analysis of all gene transcripts was performed with the Power SYBR Green PCR Master Mix (TOYOBO) on the ABI 7500 series system (Applied Biosystems, Foster City, CA). The internal reference gene was GAPDH, and the primers are listed in Table 1 .
Primers used for quantitative real-time PCR
| Gene | Primers (5′ to 3′, forward/reverse) |
|---|---|
| SOX13 | CCAGAGGGTAATGGGTCCC / TGGCTTCCATAGAGTTCCTTCC |
| PAX8 | ATCCGGCCTGGAGTGATAGG / TGGCGTTTGTAGTCCCCAATC |
| Aurora B | CAGAAGAGCTGCACATTTGACG / CCTTGAGCCCTAAGAGCAGATTT |
| Cyclin B1 | ACGAAGGTCTGCGCGTGTT / CCGCTGGCCATGAACTACCT |
| GAPDH | GGAGCGAGATCCCTCCAAAAT / GGCTGTTGTCATACTTCTCATGG |
| PAX8 promote | GAACAGAGGGAATGGCTTC/CCAGAAGTGAGAGGGATGGT |
10
Quantifying Cav1.2 and Cav1.3 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To measure the Cav1.2 and Cav1.3 mRNA levels, qPCR (quantitative real-time PCR) analysis was performed with the following sequences: Cav1.2 forward primer 5′-TCAAAGGCTACCTGGACTGGAT-3′ and reverse primer 5′-CCATGCCCTCG TCCTCATT-3′; Cav1.3 forward primer 5′-CTTCCTCTTCATCATCATCTTC-3′ and reverse primer 5′-TCATACATCACCGCATTCC-3′. To control for sampling errors, qPCR for the housekeeping gene GAPDH was performed with the primer sequences 5′-TGCTCCTCCCTGTTC-3′ (forward) and 5′-AGCCTTGACTGTGCC-3′ (reverse). The reaction solution contained 1.0 μg of diluted reverse transcription PCR product, 0.2 μM of each paired primer and Power SYBR Green PCR master mix (Toyobo). The annealing temperature was set at 58°C and 40 amplification cycles were used. The absolute mRNA levels in each sample were calculated according to a standard curve determined using serial dilutions of known amounts of specific templates plotted against the corresponding cycle threshold (CT) values. The normalized ratio of the target gene over GAPDH in each sample was calculated. The specificity of the primers was verified by both gel electrophoresis and sequencing of the PCR products.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!