The Juncao Ganoderma lucidum was obtained from the National Mycorrhizal Engineering and Technology Research Center (Fuzhou, China). American ginseng was purchased from Fujian Life Element Technology Co., Ltd. (Quanzhou, China), while Grifola frondosa was purchased from Qingyuan Hongyi Agricultural Development Co., Ltd. (Lishui, China). Cyclophosphamide was provided by Shanghai Weihuan Biotechnology Co., Ltd. (Shanghai, China). Indian ink was purchased from Shanghai Yuanye Biotechnology Co., Ltd. (Shanghai, China). IgG, IgA, IgM, TNF-α, IL-10, and other kits were purchased from Wuhan Purity Biotechnology Co., Ltd. (Wuhan, China). Qubit Fluorometric Quantification was acquired from Thermo Fisher Scientific Inc. (Waltham, MA, USA), and the Agilent 5400 Bioanalyzer was obtained from Agilent Technologies, Inc. (Santa Clara, CA, USA). The Novaseq 6000 Sequencer and Q Exactive™ HF-X Mass Spectrometer were purchased from Illumina (San Diego, CA, USA) and Thermo Fisher Scientific Inc. (Waltham, MA, USA), respectively. The Vanquish UHPLC Chromatograph was also acquired from Thermo Fisher Scientific Inc. (Waltham, MA, USA).
Agilent 5400 bioanalyzer
Manufactured by Agilent Technologies
Sourced in United States
The Agilent 5400 Bioanalyzer is a lab instrument used for the analysis of DNA, RNA, and protein samples. It employs microfluidic technology to separate and detect these biomolecules, providing detailed information about their size, concentration, and quality. The Agilent 5400 Bioanalyzer is a compact and automated system designed to handle multiple samples simultaneously, making it a valuable tool for researchers and laboratories.
Automatically generated - may contain errors
Lab products found in correlation
Novaseq 6000 platform, by Illumina (3 mentions)
Nanodrop onec spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Qiaamp fast dna stool mini kit, by Qiagen (2 mentions)
Novaseq 6000, by Illumina (2 mentions)
Novaseq 6000 sequencer, by Illumina (1 mentions)
Qubit fluorometric quantification, by Thermo Fisher Scientific (1 mentions)
Indian ink, by Yuanye Bio-Technology (1 mentions)
Nebnext ultra dna library prep kit, by Illumina (1 mentions)
Trizol kit, by Thermo Fisher Scientific (1 mentions)
Nanodrop spectrophotometer, by Implen (1 mentions)
Novaseq platform, by Illumina (1 mentions)
Nebnext ultra dna library prep kit, by New England Biolabs (1 mentions)
Universal dna purification kit, by Tiangen Biotech (1 mentions)
Truseq dna pcr free sample preparation kit, by Illumina (1 mentions)
Gel extraction kit, by Qiagen (1 mentions)
7 protocols using agilent 5400 bioanalyzer
1
Evaluation of Medicinal Mushrooms in Cancer
2
Gut Microbiome Analysis through 16S rRNA Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fecal samples from the participants were collected using a fecal collection kit and delivered on ice bags before and after intervention. Samples were frozen and stored at −20 °C until use. DNA was extracted using a QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. The purity of the DNA samples was quantified by measuring the A260/280 ratio with the Nanodrop OneC spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). DNA samples were frozen and stored at −20 °C until use. 110 DNA samples were sent to Novogene Bioinformatics Technology Co., Ltd. (Beijing, China) for paired-end 16S rRNA gene sequencing. The quality and quantity of samples were checked using an Agilent 5400 Bioanalyzer (Agilent, Santa Clara, CA, USA) before library preparation. The V4 region of the 16S rRNA gene was amplified with PCR using 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′) primers connected with barcodes [33 (link)]. 16S rRNA gene sequencing (2 × 250 bp PE V4) was performed on an Illumina Novaseq 6000 platform.
3
DNA Amplicon Sequencing for Targeted Regions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA-targeted amplicon sequencing was performed as previously described (Kurt et al., 2021 (link)). Genomic regions surrounding sgRNA targeted sites were amplified by PCR using primers (Table 5 ) with sequencing barcodes (Table S1 −3 ). Amplicon libraries were constructed using the NEB Next Ultra DNA Library Prep Kit for Illumina (NEB, MA) following the manufacturer's recommendations. Fragment sizes and quality of the libraries were checked by Agilent 5400 Bioanalyzer (Agilent Technologies, Palo Alto, CA). The qualified DNA libraries were sequenced on a NovaSeq 6000 (Illumina) for a read depth of ∼50,000 reads per cell.Table 5
The primers of PCR amplification for amplicon sequencing.
| Target region | Primer | Sequence: 5′-3′ | Length (bp) | |
|---|---|---|---|---|
| AMH | Exon1 | F | CTGAAGATGGACCGCAACGA | 278 |
| R | GGCTTTCCCAACACCACAAC | |||
| Exon3 | F | GGCATCCTTACTCCATACCTTG | 373 | |
| R | GGACACAGTGAGGACATTGC | |||
| PPARG | Exon2 | F | CTTCCTTGCTTCTTCTTCTACCA | 253 |
| R | GACAACTTACCTTACAACCTTCAC | |||
| Exon5 | F | GTACCTCGGTATGTTACTCCAG | 390 | |
| R | CCTTGTCCATCAGATATAAGAACTC | |||
| TGFBR2L | Exon2 | F | CTCGCCTACTGCTGTTCCTT | 391 |
| R | CATCCCTGTGGTGCTGTGT | |||
| Exon4 | F | TCCTTCCTCCGTGCTTCCCT | 346 | |
| R | CCTTGCCTACCATCTCGTCCAG | |||
Abbreviations: AMH, anti-Müllerian hormone; F, forward primer; PPARG, peroxisome proliferator-activated receptor gamma; R, reverse primer; TGFBR2L, TGF-beta receptor type-2.
4
RNA Extraction and Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of each sample was extracted using the TRIZOL Kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The concentration and the integrity of RNA were checked using Agilent 5400 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA) and Nanodrop Spectrophotometer (IMPLEN, Westlake Village, CA, USA). After quality control, 16 libraries were sequenced on the Illumina NovaSeq 6000 platform (Illumina Inc., San Diego, CA, USA) with 150-nt paired-end reads by NovoGene (Beijing, China). The transcriptome data of all the samples were uploaded to the Genome Sequence Archive in National Genomics Data Center (https://ngdc.cncb.ac.cn/gsa/ ), with the accession number CRA008592.
5
16S rDNA Sequencing of Mouse Cecum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The contents of the mouse cecum were obtained for 16S rDNA high-throughput sequencing. The V3 + V4 variable region was amplified using 341F (5′-CCTAYGGGRBGCASCAG-3′) and 806R (5′-GGACTACNNGGGGTATCTAAT-3′) as primers for PCR. The PCR products were then mixed with an equal volume of 1XTAE buffer and subjected to electrophoresis on 2% agarose gel for detection. After that, the PCR products were combined in equidensity ratios and purified using the Universal DNA purification kit (Tiangen biotech (Beijing, China) Co., Ltd., Beijing, China). The sequencing libraries were prepared using the NEB Next® Ultra DNA Library Prep Kit (New England Biolabs (NEB), Ipswich, MA, USA) following the manufacturer’s recommendations, with index codes added. The quality of the libraries was assessed using the Agilent 5400 Bioanalyzer (Agilent Technologies, Inc., Santa Clara, CA, USA). Finally, the libraries were sequenced on an Illumina NovaSeq platform, generating 250 bp paired-end reads.
6
Gut Microbiome Analysis through 16S rRNA Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fecal samples from the participants were collected using a fecal collection kit and delivered on ice bags before and after intervention. Samples were frozen and stored at −20 °C until use. DNA was extracted using a QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. The purity of the DNA samples was quantified by measuring the A260/280 ratio with the Nanodrop OneC spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). DNA samples were frozen and stored at −20 °C until use. 110 DNA samples were sent to Novogene Bioinformatics Technology Co., Ltd. (Beijing, China) for paired-end 16S rRNA gene sequencing. The quality and quantity of samples were checked using an Agilent 5400 Bioanalyzer (Agilent, Santa Clara, CA, USA) before library preparation. The V4 region of the 16S rRNA gene was amplified with PCR using 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′) primers connected with barcodes [33 (link)]. 16S rRNA gene sequencing (2 × 250 bp PE V4) was performed on an Illumina Novaseq 6000 platform.
7
Bacterial 16S rRNA gene amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The V4 region of bacterial 16S rRNA genes was amplified from the DNA extracts using the bacterial-specific primers (V4-515F: 5' -GTGCCAGCMGCCGCGGTAA−3', V4-806R: 5'-GGACTACHVGGGTWTCTAAT-3'). PCR enrichment was performed in a 30 μl reaction containing a 10 μl template, a fusion PCR primer, and a PCR master mix. PCR cycling conditions were as follows: 98°C for 1 min, 30 cycles of 98°C for 10 s, 50°C for 30 s, 72°C for 30 s, and a final extension at 72°C for 5 min. After validation by 2% agarose gel electrophoresis, PCR products were purified using a Gel Extraction kit (Qiagen, Germany) and then pooled in equimolar concentrations. Sequencing libraries were generated using TruSeq® DNA PCR-Free Sample Preparation kit (Illumina, United States), following the manufacturer's recommendations and qualified by the Agilent 5400 bioanalyzer (Agilent, United States). The validated libraries were used for sequencing on an Illumina NovaSeq 6000 platform (Illumina, United States), according to the standard Illumina procedures.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!