Control igg

Manufactured by Thermo Fisher Scientific

Sourced in United States

Control IgG is a laboratory reagent used to establish baseline measurements and validate experimental procedures. It is a type of immunoglobulin G (IgG) that serves as a control sample for immunoassays and other analytical techniques involving antibodies.

Automatically generated - may contain errors

Lab products found in correlation

Anti flag, by Merck Group (2 mentions) Fv10i, by Olympus (2 mentions) 4 6 diamidino 2 phenylindole (dapi), by Roche (2 mentions) Alexa fluor 488, by Thermo Fisher Scientific (2 mentions) Protein a g plus agarose, by Santa Cruz Biotechnology (2 mentions) Dynabead, by Thermo Fisher Scientific (1 mentions) Chemidoc touch imaging system, by Bio-Rad (1 mentions) Lps e coli serotype o111 b4, by Merck Group (1 mentions) Anti isg15, by Merck Group (1 mentions) Myd88 inhibitor peptide or control peptide, by Novus Biologicals (1 mentions) Anti psd95, by Merck Group (1 mentions) Anti lamp1, by Abcam (1 mentions) Anti gst, by Cell Signaling Technology (1 mentions) Anti glua2, by Merck Group (1 mentions) Anti cortactin clone 4f11, by Merck Group (1 mentions) Anti myc, by Santa Cruz Biotechnology (1 mentions) Anti glua2, by BD (1 mentions) Optima l 100k, by Beckman Coulter (1 mentions) Mp5 20f3, by BioXCell (1 mentions) Skim milk, by Fujifilm (1 mentions)

Spelling variants of this product

Mouse IgG isotype control (28 citations) Control mouse IgG (9 citations) Armenian hamster IgG isotype control (6 citations) Control mouse immunoglobulin G (IgG) (3 citations) Isotype controls IgG and IgM (2 citations) Isotype‐matched IgG controls (2 citations) Armenian hamster IgG isotype control FITC (2 citations) Isotype control IgG (MOPC-21 (2 citations) Nonspecific isotype control IgG (2 citations) Anti-Flag or IgG control antibodies (2 citations)

22 protocols using control igg

FOXC1 and FOXC2 Binding in HDLECs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human dermal lymphatic endothelial Cells (HDLECs) from juvenile foreskin (Promo Cell, #C12216) (https://www.promocell.com/product/human-dermal-lymphatic-endothelial-cells-hdlec/) were cultured and used according to the manufacturer's protocol. The cells were cross-linked with 1% formaldehyde, followed by sonication. The sheared chromatin was immunoprecipitated with dynabeads (Invitrogen, #10004D) conjugated with anti-FOXC2 antibody (Abcam, ab5060), anti-FOXC1 antibodies (Origene, TA302875 and Abcam, ab5079), or control IgG (Thermo Fisher Scientific, # 02–6202). DNA extraction and PCR were performed as previously described (Fatima et al., 2016 (link)) with primers listed in Table 4 targeting identified evolutionary conserved regions (ECRs) containing putative binding site sequences shown underlined listed below. Images were acquired with a ChemiDoc Touch Imaging System (Bio-Rad) and band intensities were analyzed with Image Lab software.

Norden P.R., Sabine A., Wang Y., Demir C.S., Liu T., Petrova T.V, & Kume T. (2020). Shear stimulation of FOXC1 and FOXC2 differentially regulates cytoskeletal activity during lymphatic valve maturation. eLife, 9, e53814.

+ Open protocol

+ Expand

LPS-Induced Sepsis in Chimeric Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Eight weeks post-BMT, chimeras were injected i.p. with 5 mg/kg LPS (E.coli serotype O111:B4; Sigma–Aldrich MO, USA). Immediately after LPS injection, mice were placed on warming pads in order to prevent hypothermia and reduce mortality^{106 (link),107 (link)}. Mice were monitored daily for the next 7 days. All experimental procedures were performed under pathogen-free conditions. In cytokine neutralization experiments, 2 h post-LPS mice received either anti-IL-6 monoclonal neutralizing antibodies (2.5 mg/kg body weight, i.v.; Thermo Fisher, USA) or control IgG (Thermo Fisher, USA) in 200 μl of sterile saline via injection into the lateral tail vein.

Kozina E., Byrne M, & Smeyne R.J. (2022). Mutant LRRK2 in lymphocytes regulates neurodegeneration via IL-6 in an inflammatory model of Parkinson’s disease. NPJ Parkinson's Disease, 8, 24.

+ Open protocol

+ Expand

Immune Cell Activation by Microbial Stimuli

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human PBMC, NK-92 cells and mouse splenocytes were rested overnight in RPMI 1640 10%, FBS and NK media without IL2, or RPMI 1640 at a concentration of 1x10⁶ cells/mL. Rested cells were treated with 30ng/μL heat-killed M. tuberculosis, 10⁶ cells/mL heat-killed S. typhimurium, 10ng/mL Pam3CSK4, 1 mg/mL poly I:C, 18 ng/mL mIL-12 or 18 ng/mL hIL-12 and 2400 ng/mL bacterially purified ISG15 (mouse or human; prepared as described in Swaim et al., 2017 (link)) for 48 hours. Supernatants were collected and monitored for IFN-γ production by ELISA (Thermo Fisher). B18R 10ng/mL (R&D Systems), MYD88 inhibitor peptide or control peptide 100μM (Novus), anti-ISG15 3μg/mL (Sigma) or Control IgG 3μg/mL (Thermo-Fisher) were used as indicated.

Swaim C.D., Canadeo L.A., Monte K.J., Khanna S., Lenschow D.J, & Huibregtse J.M. (2020). Modulation of Extracellular ISG15 Signaling by Pathogens and Viral Effector Proteins. Cell Reports, 31(11), 107772.

+ Open protocol

+ Expand

Antibody Characterization for Synaptic Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

The antibodies used were as follows: anti-cortactin (clone 4F11, Millipore); anti-GluA1 (Calbiochem); anti-GluA2 for Westerns (Synaptic systems); anti-GluA2 for co-IPs (MAB397, Millipore); anti-GluA2 for immunocytochemistry (BD Pharminogen, mouse); anti-GluA3 (Alomone, rabbit); anti-phosphoY421-cortactin (Sigma); anti-phosphoY466-cortactin (Millipore); anti-phosphoY482-cortactin (Millipore); anti-Myc (Santa Cruz); anti-Flag (Sigma); anti-GST (Cell Signalling Technologies); anti-GFP (Chromtek); anti-LAMP1 (Abcam); anti-PSD-95 (Millipore); control IgG (Thermo).

Parkinson G.T., Chamberlain S.E., Jaafari N., Turvey M., Mellor J.R, & Hanley J.G. (2018). Cortactin regulates endo-lysosomal sorting of AMPARs via direct interaction with GluA2 subunit. Scientific Reports, 8, 4155.

+ Open protocol

+ Expand

Extracellular Vesicle-Mediated Paracrine Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

miR-214^wt and miR-214^over MEFs or CAFs and HS5 or NIH3T3 control and miR-214^sponge or B16-F10, MA-2 cells were grown to sub-confluence and treated for 48 h with serum-free medium to obtain the corresponding CM to use on recipient cells which were then kept with the CM for 24-48 h, before RNA/protein extractions or biological experiments. To obtain Extracellular Vescicle-depleted CM (EVs-depleted), CM was harvested and centrifuged for 30 min at 3,000 g to remove cell debris and apoptotic bodies. After that, the supernatant was centrifuged for 2 h at 100,000 g, 4 °C using the Beckman Coulter Optima L‐100 K Ultracentrifuge with the rotor type 45 Ti 45,000 rpm. The supernatant was then collected and centrifuged again for 2 h at the same conditions to remove remaining EVs. For anti-IL-6R and anti-IL-6 blocking antibody experiments, CAFs were treated with EV-depleted B16-F10-derived CM plus 50 μg/ml of anti-mouse IL-6R (rat MAb 15A7 clone) or 10 μg/ml of anti-mouse IL-6 (rat Mab clone MP5-20F3, BioXCell), respectively, or control IgG (Thermo Fisher Scientific) for 6 h, before RNA extraction.

Orso F., Virga F., Dettori D., Dalmasso A., Paradzik M., Savino A., Pomatto M.A., Quirico L., Cucinelli S., Coco M., Mareschi K., Fagioli F., Salmena L., Camussi G., Provero P., Poli V., Mazzone M., Pandolfi P.P, & Taverna D. (2023). Stroma-derived miR-214 coordinates tumor dissemination. Journal of Experimental & Clinical Cancer Research : CR, 42, 20.

+ Open protocol

+ Expand

ChIP-qPCR Analysis of γH2AX

Check if the same lab product or an alternative is used in the 5 most similar protocols

Chromatin immunoprecipitation (ChIP) was performed as described previously (42 (link)) using a rabbit monoclonal anti-γH2AX antibody (ab81299) or a rabbit nonimmune antibody (control IgG) (catalogue number 02-6102; ThermoFisher). ChIP were analyzed by real-time QPCR using primers proximal to two sites for the restriction enzyme AsiSI located inside genes (chr20:42089225–42089433: Gene 1-FW: AAAAGTCGCTCCCGGTAAAT, Gene 1-RV: CCGATCAGACTTGGGCTTAG; chr17:61847852–61848028: Gene 2-FW: TGCAAGGCATTCGACAATAA, Gene 2-RV: ATGGAAGCCATAATGCAAGC) or primers distal to AsiSI sites (chr21:25081874–25082075: Control-FW: TGGCTGGAACTGCTTTCTTT, Control-RV: GGTGAGTGAATGAGCTGCAA). All samples were analyzed in triplicates and data normalized to the maximal recovery in each experiment, which was set equal to 1.

Cristini A., Park J.H., Capranico G., Legube G., Favre G, & Sordet O. (2015). DNA-PK triggers histone ubiquitination and signaling in response to DNA double-strand breaks produced during the repair of transcription-blocking topoisomerase I lesions. Nucleic Acids Research, 44(3), 1161-1178.

+ Open protocol

+ Expand

Visualizing SARS-CoV-2 Spike Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were seeded on glass-bottomed plates (Matsunami Glass). After transfection with the plasmid DNA, the cells were washed with PBS and fixed with 4% paraformaldehyde. Fixed cells were blocked with PBS containing 5% skim milk (Wako) for 1 h at RT. The cells were incubated with primary antibodies for the SARS-CoV-2 Spike (BLSN-005P, Beta Lifescience) or control IgG (Thermo Fisher) at 4 °C overnight. The following day, cells were washed and incubated with a secondary antibody labeled with Alexa Fluor 488 (Molecular Probes) for 1 h at RT. Nuclei were stained with 4′, 6-diamidino-2-phenylindole (DAPI, Roche). The cells were observed under a confocal microscope (FV10i; Olympus).

Hayashi H., Sun J., Yanagida Y., Otera T., Tai J.A., Nishikawa T., Yamashita K., Sakaguchi N., Yoshida S., Baba S., Chang C.Y., Shimamura M., Okamoto S., Amaishi Y., Chono H., Mineno J., Rakugi H., Morishita R, & Nakagami H. (2023). Intradermal administration of DNA vaccine targeting Omicron SARS-CoV-2 via pyro-drive jet injector provides the prolonged neutralizing antibody production via germinal center reaction. Scientific Reports, 13, 13033.

+ Open protocol

+ Expand

SARS-CoV-2 Spike Protein Visualization

Check if the same lab product or an alternative is used in the 5 most similar protocols

The cells were seeded on glass-bottomed dishes (Matsunami Glass). After plasmid transfection, the cells were washed with PBS and fixed with 4% paraformaldehyde. After blocking with PBS containing 5% skim milk for 1 h at RT, the cells were incubated with anti-SARS-CoV-2 spike proteins (BLSN-005P, Beta Lifescience) or control IgG (Thermo Fisher) at 4 °C overnight. The following day, the cells were washed twice with chilled PBS and incubated with a secondary antibody labelled with Alexa Fluor 488 (Molecular Probes) for 1 h at RT. Cell nuclei were stained with DAPI (Roche). The cells were then observed under a confocal microscope (FV10i, Olympus).

Hayashi H., Sun J., Yanagida Y., Otera T., Sasai M., Chang C.Y., Tai J.A., Nishikawa T., Yamashita K., Sakaguchi N., Yoshida S., Baba S., Shimamura M., Okamoto S., Amaishi Y., Chono H., Mineno J., Rakugi H., Morishita R., Yamamoto M, & Nakagami H. (2022). Modified DNA vaccine confers improved humoral immune response and effective virus protection against SARS-CoV-2 delta variant. Scientific Reports, 12, 20923.

+ Open protocol

+ Expand

ChIP-qPCR Protocol for Histone Modifications

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP were performed using the Magnify ChIP system according to the manufacturer’s instructions (Thermo-Fisher). Briefly, 2–3 million cells were cross-linked with 1% paraformaldehyde/PBS for 10 min and sheared using Covaris S220 ultrasonicator (10 cycles of 60 seconds, intensity 2) to obtain an average DNA fragment size of 300bp. The sheared DNA was diluted 10 times and incubated overnight at 4°C with dynabeads protein A/G and 5μg of anti-H3K27me3 (Cell Signaling, #9733) or 1 μg of control IgG (Thermo-Fisher) under constant rotation. The next day, the bound chromatin was washed and eluted by incubating the dynabeads-chromatin complexes with the reverse crosslinking buffer and proteinase K for 1 hour at 55°C and 2 hours at 65°C in a thermocycler. The DNA was purified using magnetic beads and eluted by 1-hour incubation at 55°C with 150 μL of elution buffer. DNA quality/concentration was measured with Qubit dsDNA HS assay kit (Thermo-Fisher).
For qPCR, we used the SYBR Green PCR master mix (Applied Biosystems) and a set of 3 to 5 validated primers for Tbx5, Mef2c and Gata4 ^{32 (link)}. We also used Gapdh and Pax2 primers as negative and positive controls for H3K27me3 (Active Motif, #71016 and #71020). Results were expressed as a percentage of Input DNA.

Dal-Pra S., Hodgkinson C.P., Mirotsou M., Kirste I, & Dzau V.J. (2017). Demethylation of H3K27 Is Essential for the Induction of Direct Cardiac Reprogramming by miR Combo. Circulation research, 120(9), 1403-1413.

+ Open protocol

+ Expand

Profiling miRNA-mRNA Interactions via Ago2 RIP

Check if the same lab product or an alternative is used in the 5 most similar protocols

Argonaute 2 (Ago2) RIP was used to determine the interaction between miR-124 and SPRY2 or MMP-2, using the EZ-Magna RIP™ RNA-Binding Protein Immunoprecipitation kit (cat. no. 17-701; EMD Millipore). Briefly, SRA01/04 cells (1×10⁵ cells/well) were transfected with miR-124 mimics or NC mimics for 48 h at 37°C. Cells were subsequently lysed using RIP Lysis Buffer (EMD Millipore) for 5 min at 4°C. After centrifugation 10,000 × g at 4°C for 5 min, cell lysates were conjugated to magnetic beads (2 µg; Thermo Fisher Scientific, Inc.) via rotation, using Ago2 and control IgG (cat. no. ab109761; 1:50; Abcam). The magnetic beads were treated with 0.5 mg/ml Proteinase K (EMD Millipore) to digest the protein and then immunoprecipitated RNA was isolated. The immunoprecipitated RNA was analyzed via RT-qPCR analysis.

Liu Y., Li S., Liu Y., Lv X, & Zhou Q. (2021). MicroRNA-124 facilitates lens epithelial cell apoptosis by inhibiting SPRY2 and MMP-2. Molecular Medicine Reports, 23(5), 381.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!