Enterokinase

Histidine tag from N-terminal of purified proteins was removed by incubating with the 5 units of enterokinase (Sigma Aldrich) per µg of protein in buffer (10 mM Tris-Cl pH 8.0, 10 mM CaCl₂) at 37 °C overnight. The removal of histidine tag was confirmed by western blot using anti-histidine antibodies. The fusion protein without enterokinase treatment was used as positive control. The fusion proteins were purified using Amicon ultra 0.5 ml spin column (cut off 30 kDa, Millipore).

For immunogen preparation, nheA from DSM 31 without the original stop codon was amplified by PCR (NheAfor: 5’ caccgcgcaaaatgtaattgc; NheArev: 5’ atgtgcttcaacgtttgtaacgtaatc) and cloned in pBAD202 vector (Invitrogen, USA). After confirmation of the sequence integrity (GATC Biotech, Gemany), an arabinose responsive E. coli strain (LMG194) was transformed and recombinant NheA was expressed according to the manufacturer’s protocol. The resulting recombinant protein is characterized by an N-terminally located thioredoxin tag that can be removed by enterokinase (Sigma, Gemany) digestion and a C-terminally hexa-histidine tag for purification on Ni²⁺-agarose. Batch purification was carried out according to the manufacturer’s instructions (Qiagen, Germany). The protein concentration in the eluate fraction was determined on SYPRO ruby (Invitrogen, USA) stained SDS-PAGE (G&E Healthcare Mini-System, USA) using BSA (Sigma, Germany) as standard. For cell-based assays (cytotoxicity, flow cytometry and immunofluorescence microscopy) NheA containing the original stop codon was cloned into pASK IBA5+ (IBA GmbH, Gemany) and expressed via an anhydrotetracycline inducible promoter in DH5-alpha cells. This approach resulted in an N-terminally Strep-tagged protein that was purified by StrepTactin sepharose columns (IBA GmbH, Germany) according to the manufacturer’s recommendations.

Competent E. coli BL21 (DE3) cells were transformed with pERB_C-VP1-RB_N and pET–VP1, respectively. The cells were grown by continuous shaking at 37 °C, in LB medium containing 100 μg/ml ampicillin until OD≈0.8. Protein expression was then induced by adding IPTG to a final concentration of 1 mM and the incubation was extended for an additional 4 h at 37 °C. The cells were lysed by sonication and the target protein expressed as inclusion bodies. The cyclized and linear VP1 inclusion body proteins were purified and refolded as described previously41 . The solubilized VP1 from inclusion bodies were refolded by rapid dialysis. In order to get wild type form of linear VP1, the recombinant expressed VP1 protein from pET–VP1 was digested by enterokinase (Sigma) at 4 °C for overnight to remove the fusion tag at VP1 N terminus, then the mix was incubated with Ni-NTA beads (GE Healthcare) and collect the flow-through to obtained purified linear VP1 (L-VP1). Protein concentration was measured by Micro BCA Protein Assay Kit (Thermo) and protein purity was assessed by SDS-PAGE stained with Coomassie blue. Western blot was used for detection VP1 proteins by using anti-VP1 antibody (Dako).

Bak conformational change was assessed by limited proteolysis55 (link). Briefly, 50 μl of membrane fractions resuspended in MELB with 4 μg ml⁻¹ pepstatin A (Sigma) were pre-chilled to 0 °C then incubated with 30 μg ml⁻¹ proteinase K (Roche) or trypsin (Sigma) on ice for 20 min, or 0.06 U μl⁻¹ enterokinase (Merck Millipore) at room temperature for 2 h. The reactions were stopped by addition of 1 mM phenylmethylsulfonyl fluoride (PMSF) and immunoblotted with antibodies to the Bak BH3 domain (4B5).

For the array of the solid‐phase immunoassay, chemokines were purchased from PeproTech (Rocky Hill, NJ, USA). WT human CXCL12α was bacterially expressed using a codon‐optimized cDNA (Genscript, Piscataway, NJ, USA) as a thioredoxin‐His‐tagged fusion protein from the pET‐32(+) vector with an Enterokinase cleavage site at the N‐terminus. The plasmid was transformed into E. coli BL21(DE3) cells and grown at 37°C in either Luria–Bertani or ¹⁵N‐enriched Spectra 9 medium (Cambridge Isotope Laboratories, MA, USA). CXCL12α was purified from inclusion bodies. After separation using a HisTrap HP column (GE Healthcare, Chicago, IL, USA), the sample was dialyzed against 50 mM Tris (tris(hydroxymethyl)aminomethane) buffer (pH 8), filtered, and loaded on a Heparin HP column. The bound protein was eluted in 50 mM Tris/2 M NaCl (pH 8) and further dialyzed against 50 mM Tris/2 mM cysteine (pH 8) before cleavage using Enterokinase (Novagen, Merck, Darmstadt, Germany). The cleaved protein was purified using a Mono S 5/50 GL column (GE Healthcare). The fractions containing the protein were pooled, dialyzed against 1% acetic acid, lyophilized, and stored at −20°C until further use. The correct mass of CXCL12α was confirmed by mass spectrometry.